ID: 1188375087

View in Genome Browser
Species Human (GRCh38)
Location X:29418545-29418567
Sequence CCAATTAGATATTGTTGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188375085_1188375087 -5 Left 1188375085 X:29418527-29418549 CCTGAAAACAGAATTTTTCCAAT 0: 1
1: 0
2: 4
3: 53
4: 482
Right 1188375087 X:29418545-29418567 CCAATTAGATATTGTTGCTATGG 0: 1
1: 0
2: 0
3: 10
4: 130
1188375084_1188375087 13 Left 1188375084 X:29418509-29418531 CCACTACTCAAAATGTAACCTGA 0: 1
1: 0
2: 2
3: 16
4: 150
Right 1188375087 X:29418545-29418567 CCAATTAGATATTGTTGCTATGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188375087 Original CRISPR CCAATTAGATATTGTTGCTA TGG Intronic
906824097 1:48960200-48960222 CCAATAAGATATTGGTGGAAAGG + Intronic
906830790 1:49029573-49029595 AAAATTAAATATTGTTGATATGG + Intronic
910032686 1:82749229-82749251 CACGTTAGATTTTGTTGCTACGG + Intergenic
910624990 1:89297028-89297050 CCATGTAGATATTGTAACTAGGG - Intergenic
910967885 1:92825993-92826015 CAAATTAGATAATGTTTCTTGGG - Intergenic
917708020 1:177654260-177654282 CCATTTTGTTCTTGTTGCTAAGG + Intergenic
918316428 1:183326417-183326439 CTATTTAGATATGGTTGCAAGGG + Intronic
918997988 1:191787477-191787499 CCAATTAGATATTTGTGGAAAGG + Intergenic
920524345 1:206655737-206655759 CCAATTAGCTCCTGTTGCCAGGG - Intronic
921099996 1:211920466-211920488 CCAATTAGAAAATGTCACTAGGG + Intergenic
921567474 1:216737387-216737409 CCAATCTCATATTGTTGCTAAGG + Intronic
923133851 1:231100266-231100288 CCAATTAGAAATTGGATCTAAGG - Intergenic
923735921 1:236607524-236607546 ACAATCAGATATGGTTGCTGAGG - Intergenic
1069460118 10:68586674-68586696 GCAATTGAATATTGTTTCTATGG + Intronic
1072533094 10:96337891-96337913 CCATTTGGATATTTTTCCTACGG - Intronic
1073393985 10:103203126-103203148 CAAATTAGATATTGTCCCTGGGG + Intergenic
1078704988 11:13734862-13734884 CCACTTAGATCGTGTTGGTATGG - Intergenic
1078810269 11:14753908-14753930 CCAATAAGATTTTATTGGTATGG - Intronic
1078950130 11:16121919-16121941 TCAATTAAATATTATTGTTAAGG + Intronic
1079876452 11:25863604-25863626 CCAATTTGATATTGTTTCAAAGG - Intergenic
1082235787 11:49819747-49819769 CCAATTAGACATTCTTGGGAAGG - Intergenic
1083102754 11:60327071-60327093 CCAAATATATATGGTTTCTATGG + Intergenic
1091246218 11:134097238-134097260 CCTCTTAGAAATTGTTTCTAAGG - Intronic
1093588396 12:20870176-20870198 GCAATTATATTTTTTTGCTATGG + Intronic
1095566592 12:43631508-43631530 ACAAATAGGTTTTGTTGCTAAGG - Intergenic
1095976404 12:47943351-47943373 CCAATTAGAAATTGATGGTAGGG - Intergenic
1099258557 12:80346828-80346850 CCAATTAGATGTTAGTGCTAAGG + Intronic
1101620346 12:106380810-106380832 CCATTTCAATATTGTTTCTATGG - Intronic
1107072205 13:36283004-36283026 GCATTTAGAAATAGTTGCTAGGG - Intronic
1107279727 13:38719877-38719899 CAAGTTAGATATTTTTGCAAAGG - Intronic
1108871491 13:54991956-54991978 CCAATTAGATACTCTTAGTAGGG + Intergenic
1110930783 13:81213481-81213503 CCACTTACATCTTGTTGTTAAGG - Intergenic
1111162181 13:84409167-84409189 CTAATTAAATATTGTTACAAAGG + Intergenic
1114565084 14:23624646-23624668 TCAGTTAGATTTTTTTGCTAGGG - Intergenic
1117693767 14:58338012-58338034 CCACTTAGATATTGTTCAGAAGG + Intronic
1121200106 14:92109675-92109697 CCCACTAAATTTTGTTGCTATGG + Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1127081594 15:55385826-55385848 CTAATTAGATACTGTTCCTTTGG - Intronic
1130019943 15:80220802-80220824 ATAATTAGTTATTGTTGGTATGG + Intergenic
1131015388 15:89053544-89053566 CCAATCAGATAGTGTTTCTTGGG + Intergenic
1131790732 15:95961576-95961598 CCAATTACATATTGGTGCTTTGG + Intergenic
1133492553 16:6284562-6284584 GCTATAAAATATTGTTGCTATGG - Intronic
1134185196 16:12079521-12079543 AAAATTAGCTTTTGTTGCTAAGG + Intronic
1134185286 16:12080225-12080247 GAAATTAGTTTTTGTTGCTAAGG + Intronic
1134862835 16:17575793-17575815 CCCATTAGATAGTCTTGCTTGGG + Intergenic
1137913381 16:52402393-52402415 TCAATTACATTTTGTTCCTAGGG - Intergenic
1138486358 16:57347077-57347099 CCAATTATCTATTGTTTCTTTGG - Intergenic
1154257460 18:12795868-12795890 CAAATTAAATATTATTGCCATGG + Intronic
1155736877 18:29235276-29235298 CCAGTTTGACATTGTTTCTATGG + Intergenic
1159368467 18:67500944-67500966 CCAATAAGATAAGGTTGTTAGGG - Intergenic
1160412854 18:78686768-78686790 CAAAATATATTTTGTTGCTAAGG - Intergenic
1165344506 19:35236063-35236085 CCAATTAGAATTTGTTGCCTAGG + Intergenic
928264385 2:29799112-29799134 CCAGCTAGATATTGTTCATATGG + Intronic
928744671 2:34397294-34397316 CTAATTAGATATTGTCAGTATGG - Intergenic
929309780 2:40409242-40409264 CCAATCATATTTTGTTACTAGGG + Intronic
930231378 2:48847216-48847238 CTAACTAGATATTGATGCTCAGG + Intergenic
934070300 2:88377730-88377752 CAAATAAGTTTTTGTTGCTAAGG + Intergenic
938635232 2:133218084-133218106 CCAAAGAGATTTTGTTGTTATGG + Intronic
941192890 2:162408270-162408292 CCAATTGGGTATTGTTTCTTGGG + Intronic
942670755 2:178374417-178374439 CATATTAGATATTTTTGCTAGGG + Intronic
943114497 2:183649570-183649592 CCACATAGATAGTGTTCCTATGG - Intergenic
944577079 2:201100121-201100143 GCAATTAATTATTCTTGCTAAGG + Intergenic
946395115 2:219439788-219439810 CCCATTGGTTATTTTTGCTACGG + Intronic
946457683 2:219841197-219841219 CCAATTAGATATTTACGCTTGGG + Intergenic
946511091 2:220357288-220357310 CCAATTACAAATTGTTGGTATGG + Intergenic
1169487499 20:6045537-6045559 ACAAATAGATATTGTTATTATGG + Intronic
1171041533 20:21768441-21768463 CCAATTAGATTTTTTTTCCAAGG + Intergenic
1173754969 20:45508010-45508032 CCACTTTGTTATTGTTGTTAAGG + Intergenic
1178246519 21:30957969-30957991 GCAATGAGATAGGGTTGCTATGG + Intergenic
1178791655 21:35705824-35705846 CCAATTTTCTATTTTTGCTATGG - Intronic
1183133832 22:35867593-35867615 CTAACTAAATATTGTTGCTTTGG + Intronic
1184711627 22:46253770-46253792 TCCTTTAGAAATTGTTGCTATGG + Intergenic
1184964491 22:47960510-47960532 CCTAATAAATATTGTTTCTATGG + Intergenic
951636191 3:24780207-24780229 CCAATGATATAATGTTGATAGGG - Intergenic
959377400 3:105603236-105603258 CCATTGAGATATTCTTTCTAAGG - Intergenic
963369203 3:144376633-144376655 ACAATCAGATATTGTTCCTGTGG - Intergenic
963808948 3:149756099-149756121 CCAATTAGATATTGCTGGGTTGG - Intergenic
964224428 3:154381592-154381614 CCAATTAGAGATTTCTGGTATGG - Intronic
965071572 3:163922589-163922611 TCAGTTAGATTTTATTGCTAGGG + Intergenic
965494283 3:169378628-169378650 TCAATTAGACATGGTTGATATGG + Intronic
966201600 3:177364200-177364222 CCAATTAGCTTATGTAGCTATGG + Intergenic
967320184 3:188187358-188187380 TCTATTAGATTTTGATGCTAAGG - Intronic
970825542 4:20268892-20268914 ACAAATAGTTATTGTTGCTTTGG + Intronic
971452739 4:26815173-26815195 CCAATAAGAAATTGTGGCTTTGG + Intergenic
979172389 4:117618079-117618101 CCATTTGTATATTTTTGCTATGG - Intergenic
980150127 4:129036094-129036116 TTAATTATATATTGTGGCTAAGG - Intronic
981171337 4:141627081-141627103 CCAAATAGTTATTTTTGCCATGG - Intergenic
985589918 5:759196-759218 CAAAATACAGATTGTTGCTAGGG - Intronic
987324912 5:16804009-16804031 ACAATAAGATATTGTCCCTACGG + Intronic
988438321 5:31202910-31202932 TAAATTAGAAACTGTTGCTAAGG - Intronic
989126530 5:38058494-38058516 CCAATTTATTTTTGTTGCTAGGG + Intergenic
989328054 5:40222837-40222859 CTAATTAAATATTGCTGCTTTGG + Intergenic
992408939 5:76486047-76486069 CCAATTAATGATAGTTGCTATGG + Intronic
994110467 5:95997407-95997429 CCAATTAGATATTGATGATGTGG + Intergenic
994255209 5:97585201-97585223 ACAATTAGATAATAGTGCTAAGG + Intergenic
994784253 5:104135435-104135457 CCAAGTAGATATTGTAGACAGGG + Intergenic
995020632 5:107363274-107363296 GCAATTAGAAATGCTTGCTATGG - Intergenic
995615785 5:113961697-113961719 CCAATCAGATAATTTTGCTGAGG - Intergenic
998783735 5:145686440-145686462 CTGTTTAGATCTTGTTGCTAAGG - Intronic
1000060720 5:157652629-157652651 CCTATTAGCTAATGTTGCTGGGG + Intronic
1010304610 6:74304495-74304517 TCCATTAGATATTCTTCCTAAGG - Intergenic
1010642613 6:78347792-78347814 CCAAATAGAAGGTGTTGCTAAGG + Intergenic
1012026703 6:94003805-94003827 CCTAATAGATATTGTTGAAATGG - Intergenic
1015684893 6:135848877-135848899 CCAATTATATGTTGGTGTTAAGG - Intergenic
1017551663 6:155516132-155516154 CCAATTAGATTGTGTTGTTTAGG + Intergenic
1021880578 7:25091833-25091855 CCAGTGACATATTGTAGCTATGG - Intergenic
1023364345 7:39448753-39448775 CCAATAAAATATTGATGCAATGG + Intronic
1023536093 7:41212921-41212943 ACACTTAAATATTGTTGGTAGGG - Intergenic
1023676859 7:42639968-42639990 ACACTTTGATATTTTTGCTACGG + Intergenic
1027877625 7:83790606-83790628 CTAATCAGCTCTTGTTGCTAAGG + Intergenic
1028734291 7:94189709-94189731 CCCATTAGATTTTTTTTCTATGG - Intergenic
1030789761 7:113709288-113709310 ACAAGTAAAAATTGTTGCTATGG - Intergenic
1032618655 7:133503350-133503372 ATAATCAGAGATTGTTGCTATGG + Intronic
1033034329 7:137859205-137859227 ACAATTAGAAATTGTTACAATGG + Intergenic
1038577768 8:28719945-28719967 CCAATTAGGTATTATTGCGATGG - Intronic
1041254480 8:55968092-55968114 CCAATTAGCTCTTGTGGCTTGGG + Intronic
1041837470 8:62232677-62232699 TCAATTGGAGATTGATGCTAAGG - Intergenic
1044393780 8:91684448-91684470 TTAATTAAATATTGTAGCTAGGG - Intergenic
1044767761 8:95594863-95594885 ACACTCAGCTATTGTTGCTAAGG - Intergenic
1044889736 8:96821300-96821322 CCAATTATATATTTTTGCTTGGG + Intronic
1044902608 8:96963999-96964021 CCATTTCTATATTATTGCTATGG + Intronic
1046036743 8:108852059-108852081 ACAATGAGATATTGTTATTATGG + Intergenic
1047817413 8:128479918-128479940 CCATCTAGGTATTGGTGCTATGG - Intergenic
1050279048 9:4031789-4031811 TCAATTAGAAATTGTTCCAATGG + Intronic
1050496535 9:6248131-6248153 ACAATGTGATATAGTTGCTATGG + Intronic
1050796815 9:9556606-9556628 TCAGTAAGTTATTGTTGCTAGGG + Intronic
1052436426 9:28436133-28436155 GCAATTACAGGTTGTTGCTATGG - Intronic
1054931775 9:70642564-70642586 CCAATTAAATCATGTTGCTTGGG + Intronic
1059022673 9:110593644-110593666 CCTATTAGCTATTCTTCCTAAGG + Intergenic
1060487357 9:124056566-124056588 CCAATTAGAAAATGTAGCTGGGG + Intergenic
1187558059 X:20371946-20371968 GCAAGTAGATATTCTTGCTTTGG + Intergenic
1188288314 X:28356539-28356561 CTAATCAGATATTGATGCAAGGG + Intergenic
1188375087 X:29418545-29418567 CCAATTAGATATTGTTGCTATGG + Intronic
1190981941 X:55463994-55464016 CCAATTAGACCTTTATGCTAGGG + Intergenic
1190986757 X:55509186-55509208 CCAATTAGACCTTTATGCTAGGG - Intergenic
1191129235 X:56990562-56990584 CCAATTATATATTGAAGCTGTGG - Intronic
1192609095 X:72549739-72549761 CCAATTAGATATAAATGATAAGG - Intronic
1192683051 X:73273181-73273203 CAAATTAGTTATTTTTGCTTAGG - Intergenic
1192787080 X:74346196-74346218 CCAAATATATCTTGTTGATATGG + Intergenic
1193916217 X:87367488-87367510 CCAATAAGGTATTCCTGCTAAGG + Intergenic
1201666988 Y:16468892-16468914 CCAATTAAATATTGATGGTTAGG + Intergenic