ID: 1188376474

View in Genome Browser
Species Human (GRCh38)
Location X:29435968-29435990
Sequence AGTTATGTTTTTTCCCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188376474_1188376477 30 Left 1188376474 X:29435968-29435990 CCATTAGGGGAAAAAACATAACT 0: 1
1: 0
2: 5
3: 43
4: 309
Right 1188376477 X:29436021-29436043 AATATATAAACCATTCTTTCAGG 0: 1
1: 0
2: 4
3: 28
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188376474 Original CRISPR AGTTATGTTTTTTCCCCTAA TGG (reversed) Intronic
901859676 1:12066266-12066288 ACTTCTGTTTTTTCCAGTAAAGG + Intronic
904894861 1:33807989-33808011 AGTAATGTTTTTAACCTTAAAGG - Intronic
905090339 1:35425795-35425817 TGTTTTGTTTTGTCCCCTAAGGG + Intergenic
905503713 1:38459672-38459694 AATTTTTTTTTTTCCCCTGAGGG - Intergenic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
907641183 1:56191926-56191948 TGTGATTTTTTTTCCCCCAATGG - Intergenic
907787807 1:57630459-57630481 AGTTATTTGTTTCACCCTAAGGG + Intronic
908213046 1:61921150-61921172 AGTTATGTCTTTTTTCCTAATGG - Intronic
908614365 1:65901811-65901833 AGTTATGTTTTTTCTTCTGATGG + Intronic
909198750 1:72661380-72661402 AGTTGTGGTTCTTCCTCTAAGGG + Intergenic
909335481 1:74467571-74467593 AATTATATTTTTTTCTCTAAAGG + Intronic
909688517 1:78378190-78378212 AGGTTTCTTTTTTCCCCTGAAGG - Intronic
909844207 1:80370260-80370282 ATATATGTTATTGCCCCTAAAGG + Intergenic
910081077 1:83342387-83342409 AAGAATGTTTTTTCCCCTTAGGG - Intergenic
910508283 1:87975453-87975475 AGATATTTTTTCTCCCCTACAGG - Intergenic
910635737 1:89405485-89405507 AATTTTTTTTTTTCCCCTAGTGG - Intergenic
911647965 1:100355816-100355838 AGTTCTGTTATTTTCCCTACAGG - Intronic
912232562 1:107812756-107812778 TGTCATGTTTTTTTCCCTTAAGG + Intronic
913440548 1:118892660-118892682 ACTCATGTTTTTTCTCCTACTGG + Intronic
919269359 1:195318966-195318988 AGATATGTTTTTACCTCTCAAGG + Intergenic
919604321 1:199662454-199662476 AATTATGTATTTTATCCTAAAGG + Intergenic
921394952 1:214658829-214658851 AGTTATTTTTTTTGCCCTTAGGG + Exonic
922074855 1:222233517-222233539 TGTTAGGCTTTTTTCCCTAAGGG + Intergenic
922992676 1:229928528-229928550 AGTTATGTTTTTTTCTAAAATGG - Intergenic
924530830 1:244892303-244892325 AGTTATGTAGATTCCACTAATGG + Intergenic
1063246406 10:4224247-4224269 AGTAAACTTTTTTTCCCTAAGGG - Intergenic
1063734385 10:8735771-8735793 AGTTATGTTTTTTCCAGTAACGG - Intergenic
1064726813 10:18288615-18288637 AACTATGTTTTTTCTCCTCAGGG - Intronic
1065023623 10:21520796-21520818 AGTTATTTTTTTTTAACTAAGGG + Intronic
1065277638 10:24101289-24101311 AGTTTCATTTTTTTCCCTAATGG + Intronic
1066114586 10:32228234-32228256 ATTTTTTTTTTTTCCCTTAACGG - Intergenic
1066313321 10:34219322-34219344 AGTTATTTTCTTTCTGCTAATGG - Intronic
1068330068 10:55552973-55552995 TGTTTTGTTTCTTTCCCTAATGG - Intronic
1068760646 10:60705001-60705023 AGCTATGTTTTGTCCCTGAATGG - Intronic
1068917617 10:62449372-62449394 AGTTCTGTTTCTTGACCTAATGG + Intronic
1070652450 10:78247549-78247571 AAATATTTTTTTTCCCCCAAAGG + Intergenic
1070752977 10:78974701-78974723 CGTGATGTGTTTTCCCCTCATGG - Intergenic
1071480217 10:86059627-86059649 GCTAATGTTTTTTCCCCAAATGG - Intronic
1072120008 10:92397894-92397916 AGTTAATTAGTTTCCCCTAAGGG - Intergenic
1073074949 10:100818136-100818158 AGTTATGTTTTCTGGCCTTAGGG + Intronic
1073810611 10:107148599-107148621 AATTATGTCTTTCCCTCTAATGG + Intronic
1073937163 10:108647510-108647532 AGATAATTTATTTCCCCTAAAGG + Intergenic
1074034737 10:109727002-109727024 AGTTAACTTTTTTTCCGTAAAGG - Intergenic
1075105946 10:119540104-119540126 ACTTATGTTATTTTCCATAATGG + Intronic
1075881678 10:125857566-125857588 AGGTATGTAATTTCCCCTGAAGG - Intronic
1076377074 10:129997684-129997706 AGTTTTTTTTTTTCCCCTCAGGG - Intergenic
1076508034 10:130991413-130991435 AGTTGTCTCTTTTCCACTAAAGG - Intergenic
1077772889 11:5239993-5240015 ACTTATGTGTTTTCCACTAAAGG + Intergenic
1077814335 11:5670721-5670743 AGTTATGTTCAATCCCCTCAAGG - Intronic
1078349139 11:10578295-10578317 ACTTTTGTCTTTTCTCCTAACGG - Intronic
1078582362 11:12548304-12548326 AGGAATTTTTTCTCCCCTAATGG - Intergenic
1078654711 11:13227689-13227711 TTTTATTTTTTTTCCCCAAAAGG + Intergenic
1079595790 11:22244733-22244755 AGTTTTGTTTTTTCCTAAAATGG + Intronic
1080399578 11:31921687-31921709 GGCTAAGTTTTTTCCTCTAATGG + Intronic
1080530454 11:33170172-33170194 AGTAATGATTTTTCTCTTAAAGG + Intergenic
1081508091 11:43739128-43739150 AGCAATGTTTTGTACCCTAAGGG + Intronic
1086107965 11:83168021-83168043 TGTTATGTTTTTTCCCTTTAAGG + Intronic
1088506154 11:110529734-110529756 AGTTGTGTTTCTTGCCCTCAGGG + Intergenic
1088961162 11:114666380-114666402 AAAGATTTTTTTTCCCCTAAAGG + Intergenic
1091688800 12:2582000-2582022 ACTTATATTGTTTCCCCTAATGG - Intronic
1093157269 12:15701795-15701817 TGTTATTTTTCTTCCCCTAAGGG - Intronic
1093237902 12:16634676-16634698 AAGTATTTTTTTTCCCTTAAGGG + Intergenic
1093294031 12:17365836-17365858 AGTTATGTTTTCTTCTCTAGCGG - Intergenic
1094052934 12:26240355-26240377 AGATATATTTTTTTTCCTAAAGG - Intronic
1094162288 12:27404513-27404535 AGCTTTATTTTTTCCCCAAATGG - Intronic
1095063863 12:37740205-37740227 TGATATGTGTTTTCTCCTAACGG + Intergenic
1095783441 12:46085772-46085794 AATTATATTTTTGCCCCAAAGGG + Intergenic
1097019531 12:56010002-56010024 AATTATTTTTTTTCCCCAACTGG + Intronic
1097458981 12:59836360-59836382 AATAATTTTTTTTCCCATAATGG - Intergenic
1097540324 12:60935214-60935236 ACTTTTGTTTTTTCCCTTGAGGG + Intergenic
1097713806 12:62943755-62943777 AGACATGTTTTCTCCCCTATAGG + Intergenic
1098152659 12:67563667-67563689 AGTTATGTTTTCTCCCAGAAAGG + Intergenic
1100180658 12:92082234-92082256 AATGAAATTTTTTCCCCTAAGGG - Intronic
1100488507 12:95055129-95055151 TCTTAAGTTTTTGCCCCTAAAGG + Intronic
1100731669 12:97477676-97477698 AAGTATGTTTGTTCCCTTAAAGG - Intergenic
1101000489 12:100352847-100352869 AGTTACATTATTTTCCCTAAGGG + Intergenic
1101090009 12:101275595-101275617 AGTTCTGCCTTTTCCCTTAACGG - Intergenic
1101488804 12:105193111-105193133 AGTCATTTTTTTTCCCCCCAGGG + Intronic
1101915984 12:108896552-108896574 AGTTAGGCTTTCTTCCCTAAGGG - Intronic
1103461818 12:121111028-121111050 TGTTTTGTTATTTCCCCGAATGG + Intergenic
1105622734 13:22084578-22084600 AGATGTGGTTTCTCCCCTAATGG + Intergenic
1106405568 13:29470116-29470138 AGTTGTGTTTTTCTCCCTGAGGG - Intronic
1106722342 13:32448368-32448390 AGTGATTTTTTTTCTTCTAATGG - Intronic
1107004015 13:35586240-35586262 AGTTAATTTTTTCCCCATAATGG - Intronic
1107193853 13:37623289-37623311 TCTTATCCTTTTTCCCCTAATGG + Intergenic
1108131230 13:47302636-47302658 AGTTATTTTTTTTTCCCTGTTGG - Intergenic
1108444178 13:50490314-50490336 AGTTAGGTTTATTCTCCTTAAGG + Intronic
1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG + Intergenic
1109657159 13:65407964-65407986 AGTTTTTTTTTTTTCCGTAAAGG - Intergenic
1109757598 13:66781099-66781121 AGTTATGACTTTTCCTGTAAAGG + Intronic
1110043814 13:70802344-70802366 AGCTATGTCTTTTCTCATAACGG - Intergenic
1110589201 13:77235179-77235201 ATTTCTGTTTTTTTCCCTAGTGG - Intronic
1112104453 13:96225410-96225432 AGTATTGTTTTTTTCCCCAAAGG + Intronic
1112921344 13:104616460-104616482 AGTTATGCTTTCTCTCCTATAGG + Intergenic
1115337605 14:32257338-32257360 TGTTTTGTTTTTTCCCCAGAGGG + Intergenic
1115343537 14:32318125-32318147 CTTTATGTTTTTTCCCCTCTGGG - Intergenic
1115766111 14:36625155-36625177 AGCTATGCTCTTTCCCCAAAAGG + Intergenic
1116095875 14:40366763-40366785 AGTTTCTTTTTTTCCCTTAAAGG + Intergenic
1116365173 14:44051696-44051718 TTTTATCTTTTTTCCCTTAAGGG - Intergenic
1116740666 14:48750219-48750241 AGGCATGTTTTTACCCCTGAAGG + Intergenic
1117441445 14:55763265-55763287 AGTTATCTTTTTTCCTCTTTTGG - Intergenic
1117524798 14:56588712-56588734 ATTTATGTATTGTCCCCTTAAGG + Intronic
1118335597 14:64851174-64851196 AATTATGTTATTTCCGCTAGTGG + Intronic
1118803779 14:69216149-69216171 AGTTTAATTTTTTCTCCTAAAGG + Intronic
1119250930 14:73153096-73153118 ATTTATTTTTTTTCTCCTCAAGG - Intronic
1119593680 14:75914048-75914070 ATATATATTTTATCCCCTAAGGG + Intronic
1122001993 14:98666327-98666349 TGTTATTTTTTTTCACCTCAAGG + Intergenic
1122759166 14:104008470-104008492 AGTTAAGTTTTTTGACCAAATGG + Intronic
1123139943 14:106066106-106066128 AGTTCTATTTTTTCCCATGATGG + Intergenic
1123790280 15:23712563-23712585 AGTTATGTCTTTTCCAGAAATGG + Intergenic
1124387301 15:29220805-29220827 AGTTTTTTTTTTTCCCTAAAAGG - Intronic
1124723160 15:32131055-32131077 AGTTTTGTTTTTCCCCCTTACGG + Intronic
1125162559 15:36663035-36663057 AGAGATGTTTTTACCTCTAAAGG - Intronic
1125245270 15:37629506-37629528 AGATTTTTTTTTTCCCCTAAAGG + Intergenic
1126010016 15:44293849-44293871 AGTTATGTTTTTCCTCCTTAAGG + Intronic
1126412027 15:48382070-48382092 GGTTTTGTTTTTTCCTCTAACGG + Intergenic
1126998283 15:54471582-54471604 AGTTAGGTCTTTTCACCTTATGG - Intronic
1129630488 15:77254213-77254235 AGTTATGTTTTTGCCCAATATGG + Intronic
1129803729 15:78437365-78437387 ACTTTTGTTTCTTCTCCTAAGGG - Intergenic
1131603016 15:93869224-93869246 AGTTATATGTTTACCCCTTAGGG - Intergenic
1134139144 16:11702108-11702130 ATATATGTTTTTTCCCCTACAGG + Intronic
1134875915 16:17698517-17698539 ATTTATCCATTTTCCCCTAATGG + Intergenic
1135800701 16:25492425-25492447 AGTTATCCTGTTCCCCCTAAGGG - Intergenic
1135832886 16:25793545-25793567 AATTATGTTTCTTGCCTTAAAGG + Intronic
1137022030 16:35437724-35437746 AGTTATGTTTTTGCCCATCAAGG - Intergenic
1137781742 16:51103312-51103334 AGTTTTGTATTTACCCCAAATGG - Intergenic
1138740662 16:59305698-59305720 ATTTATGTTCTTTATCCTAAAGG + Intergenic
1139534122 16:67561438-67561460 ACTCTTTTTTTTTCCCCTAAAGG - Intergenic
1140134348 16:72192303-72192325 AGGTATTTTGTTTCACCTAATGG + Intergenic
1141354819 16:83335506-83335528 TTTTATGTTTCTTGCCCTAAGGG + Intronic
1141506089 16:84479684-84479706 AGTTTTCTTTTTTTCCCTACAGG - Exonic
1141810558 16:86372780-86372802 AGAGATAATTTTTCCCCTAAAGG + Intergenic
1142821095 17:2467874-2467896 AGTCCTGTTTTTTCTCCTAGTGG - Exonic
1144335180 17:14262256-14262278 ATTTATGTTTATTCTGCTAAGGG + Intergenic
1144443205 17:15302604-15302626 TGTTCTGTTTTTGCCTCTAATGG - Intergenic
1145802344 17:27696154-27696176 ATTTATTTGTTTTCCTCTAAGGG - Intergenic
1148919181 17:51014795-51014817 ATTTATGTTTTTAACCTTAAAGG - Intronic
1156991922 18:43419537-43419559 AGTTATGTTCTTTCCACTTCTGG + Intergenic
1158580491 18:58676915-58676937 CATTATGGTTTGTCCCCTAAAGG + Intronic
1165592585 19:36982804-36982826 AGTTAGGTTTTTCCCAATAAAGG - Intronic
926294482 2:11558937-11558959 TGTAAGGGTTTTTCCCCTAAAGG - Intronic
926650152 2:15334842-15334864 TGTTATGTTTCTTTGCCTAAGGG - Intronic
927531368 2:23806262-23806284 TGTTTTGCTTTTTCCCCTACTGG + Intronic
928631440 2:33197015-33197037 AGAAATGTTTTTTTCCCTACAGG - Intronic
929472007 2:42203275-42203297 AGTTTGGTTTTTTCCCCTCATGG + Intronic
930180092 2:48346942-48346964 AATTATGTTTTGTCCACTATAGG + Intronic
930744509 2:54867746-54867768 AGGTATTTTTTTTCCCCTTTTGG - Intronic
930905713 2:56564443-56564465 AGTTTTGTTTTTTCCCATGCAGG + Intergenic
931335944 2:61343661-61343683 AGTTTTTTTTTTTCCCCCAAGGG - Intronic
932258542 2:70307654-70307676 ATTTATATTTTTTCCCTTTATGG + Intergenic
933188981 2:79311868-79311890 ATTTATGCGTTTTCTCCTAAGGG + Intronic
936606615 2:113963958-113963980 TGTTACGTATTTTCCCCTCAAGG + Intergenic
937544352 2:122998792-122998814 ATTTATGTTTTGTTCCTTAAGGG + Intergenic
937845812 2:126577441-126577463 AGTTCTCTTTTGTCCCCTGATGG - Intergenic
938641603 2:133286563-133286585 CTTTATGATTTTTCCCCTAGTGG - Intronic
939295561 2:140259679-140259701 ATTTATGTATTTTACCCCAATGG - Intronic
939881362 2:147635194-147635216 TGTTTTTTTTTTTCCGCTAATGG - Intergenic
940478576 2:154198498-154198520 AAGTAAGTTTTTTCCCCTTATGG + Intronic
944741858 2:202620266-202620288 TGGTTTGTTTTTTCCCTTAAAGG - Intergenic
944892493 2:204131832-204131854 AGTCAAGTATTTTCCCCCAAGGG - Intergenic
946298589 2:218807319-218807341 AGTTTTGTTTTTTTCCTTAAAGG - Intronic
946892825 2:224296012-224296034 AGTAATATTTTTTCCCCCAATGG - Intergenic
947013700 2:225593828-225593850 ATTTTTGTTTTTTCACTTAATGG - Intronic
1170233120 20:14072200-14072222 AGTTATGTTTTTTTCCTCTAGGG + Intronic
1170593373 20:17787695-17787717 CGTTATGTTTTTTCTCCTCTAGG + Intergenic
1177915792 21:27086927-27086949 AGTAGTATTTTTTACCCTAAAGG + Intergenic
1184451988 22:44588218-44588240 ATTTATATTTTTTCCCAAAAAGG - Intergenic
1184589138 22:45469817-45469839 TGTTTTTTTTCTTCCCCTAACGG - Intergenic
1184899823 22:47438834-47438856 TCTTATGTTTTTTCCCCTTTTGG + Intergenic
949393035 3:3584088-3584110 AGTTATATATTTTCTCCTATAGG - Intergenic
952704967 3:36368009-36368031 CTTAATATTTTTTCCCCTAAGGG + Intergenic
954021097 3:47742496-47742518 ATTTATGGTTTTTCTCCTGAAGG - Intronic
954951991 3:54483291-54483313 AATTTTGTTTTTGACCCTAAAGG + Intronic
956454964 3:69411483-69411505 AGTTATGTTTTTCATCCTACAGG + Intronic
956485172 3:69715049-69715071 AGATATAATTTTTCTCCTAATGG + Intergenic
957125728 3:76157664-76157686 AGTTCTGTTGTTTCCACAAAAGG - Intronic
957206190 3:77201783-77201805 TTTTGTGTTTTTTCCCCTCATGG - Intronic
957357644 3:79112991-79113013 AGTCATGTTTTATCACCAAATGG + Intronic
957383302 3:79462678-79462700 AGTTATGTCTGATTCCCTAATGG - Intronic
957726928 3:84078755-84078777 AATTCTGTTTTTTCGCCTTACGG - Intergenic
958503065 3:94938370-94938392 AGGGATTTTTTTTTCCCTAATGG + Intergenic
959891868 3:111565669-111565691 AGTGATTTTTTTTCTCCTTAAGG + Intronic
960112052 3:113854747-113854769 AGTTATGTTTTTCCCCAAAAAGG - Intronic
964502540 3:157364497-157364519 AGTGCTGATTTTTCTCCTAAAGG + Exonic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
965158576 3:165099235-165099257 AATTCTGTTTTGTTCCCTAATGG + Intergenic
965393980 3:168139651-168139673 AGCTATGTTTTTTTCCTTTATGG + Intergenic
965617703 3:170611889-170611911 AGTGCTGTCTTTTCCCCTAATGG + Intronic
967475802 3:189916158-189916180 TGTTATTTTTTTTCCCCTTTTGG - Intergenic
969942941 4:10753203-10753225 AGTTATGCTTTTTGCCATTAAGG + Intergenic
969966237 4:10999511-10999533 TGTTTTTGTTTTTCCCCTAAGGG - Intergenic
971702790 4:30001150-30001172 AATTAAATTTTTTCCCCTTACGG - Intergenic
972375606 4:38466681-38466703 CGATATGTTTTTTTCCCCAAGGG - Intergenic
972859351 4:43148347-43148369 TGTTATTTTTTTTTCCTTAAAGG - Intergenic
973680906 4:53318727-53318749 TGTTTTTTTTTTTCCCCTGATGG + Intronic
974136488 4:57825074-57825096 AATTATGCTTTCTTCCCTAAGGG - Intergenic
974159416 4:58118790-58118812 AGTAATGTTTTTTCCACTTTGGG + Intergenic
974948446 4:68557796-68557818 AGTTAAGTTTGATTCCCTAAAGG - Intronic
974957470 4:68660196-68660218 AGTTAAGTTTGATTCCCTAAAGG - Intronic
975082991 4:70302712-70302734 AGTTATGTGTTTTATGCTAAGGG - Intergenic
975091570 4:70410292-70410314 ATTAATTTTTTTTCCCATAAAGG - Intergenic
975350944 4:73345604-73345626 AGTTTTCTTTTTTGCCCTGAGGG + Intergenic
975527530 4:75367090-75367112 TGTAATATTTTTTCCTCTAAAGG - Intergenic
976306993 4:83569964-83569986 AGTTATCTTTCTTCCCTCAAAGG + Intronic
977451959 4:97210335-97210357 AGAGATTTTTTTTCCCCTCAGGG - Intronic
977521373 4:98088663-98088685 TTTTTTTTTTTTTCCCCTAAAGG - Intronic
979009363 4:115347486-115347508 AGTTATGTTTATTGCTCTAGAGG - Intergenic
979340766 4:119521060-119521082 ACTTATGTTTTATTCCCTAAAGG - Exonic
979483678 4:121247061-121247083 ACTTTTTTTTTTTCCCCCAAAGG + Intergenic
979553495 4:122018132-122018154 ACTTATGTTTGGTCTCCTAAAGG + Intergenic
979935863 4:126694592-126694614 AGTTATGTGTTTTCCCTTAGAGG + Intergenic
979963549 4:127050165-127050187 AGTTATGTTCTTTGCCTTCAAGG - Intergenic
980321445 4:131283839-131283861 AGACATTTATTTTCCCCTAATGG + Intergenic
981135637 4:141207799-141207821 AGTTCTATTTTTACCACTAAAGG + Intronic
981317989 4:143360376-143360398 AGTTTTGTTTTTTGAACTAAAGG + Intronic
981713985 4:147734398-147734420 AGTTATGTTTCTTATGCTAAAGG - Intronic
982857321 4:160400569-160400591 AGTATTCTTTTTTACCCTAATGG - Intergenic
982922026 4:161287808-161287830 AGTTAACTTGTTTCCCCTGAGGG - Intergenic
983779046 4:171644970-171644992 AGTTTTGTTTTTTCACCTAAGGG - Intergenic
984107695 4:175570745-175570767 AGTATTGATTTTTCACCTAAGGG + Intergenic
984519943 4:180789192-180789214 ATTTATGTTTTTTGCCCTTCAGG - Intergenic
984582656 4:181528080-181528102 ATTTCTGTTTTTTTTCCTAAAGG - Intergenic
984969819 4:185178210-185178232 AGTAAGCTATTTTCCCCTAACGG + Intronic
985317281 4:188671971-188671993 AGTTATGTTCATTTCCCTTATGG - Intergenic
985359960 4:189163028-189163050 AGTTTTGTTTTTTTTCCTTATGG - Intergenic
985441989 4:189988673-189988695 ACTTCTTTTTTTTCCCCTGAGGG + Intergenic
986340229 5:6782785-6782807 TTTTATGTTTTTTCCCTTATTGG + Intergenic
987670968 5:21008019-21008041 AGTTATGTTTTTTTCCCCTCCGG - Intergenic
987735488 5:21837705-21837727 TGTTCTGTTTTTTCCTCTAAAGG + Intronic
988126089 5:27039688-27039710 ACTTCTTTTTTTTCCCCCAATGG + Intronic
990866232 5:60383448-60383470 TGTAGTGTGTTTTCCCCTAAGGG - Intronic
991479861 5:67066539-67066561 AAATATCTTTTTTCCCCTAATGG + Intronic
992136021 5:73746663-73746685 AGGCATGTTTTTGCTCCTAATGG + Intronic
992278286 5:75144572-75144594 AGTTAATTTTTGTCCCCTGAGGG - Intronic
993049147 5:82905951-82905973 AGTTATGTTTTTTCTCTTAATGG - Intergenic
993216891 5:85036327-85036349 ATTTATGGTTTTTACCATAAAGG + Intergenic
993770096 5:91916168-91916190 TGTTTTGTTTTTGCCCCAAAAGG + Intergenic
994261819 5:97668482-97668504 ACTTGTGTGTTTGCCCCTAAAGG - Intergenic
994703147 5:103162710-103162732 AGTTCATTTTTTTCCCCTTAGGG + Intronic
995235801 5:109828690-109828712 ATTTAAGATGTTTCCCCTAAGGG - Intronic
996543247 5:124651680-124651702 TGTTATTGCTTTTCCCCTAAGGG + Intronic
996786879 5:127247214-127247236 AGTTTTTTTTTCTCCTCTAATGG - Intergenic
996921495 5:128772769-128772791 AGTTATATTTTTTTCCCTCCTGG - Intronic
999038177 5:148376956-148376978 AGTTAAGTTTTGTCCAGTAAAGG - Intergenic
999082126 5:148854756-148854778 AGGTATGACTTTGCCCCTAAAGG + Intergenic
999466163 5:151807467-151807489 AATTATCTTGTTTGCCCTAAAGG - Exonic
1000549156 5:162637330-162637352 AGTTATTTTTATTCCCCTTTGGG - Intergenic
1000593586 5:163187848-163187870 AGTTTTGTTTTTCCCTCTATTGG - Intergenic
1003577123 6:7307417-7307439 AGTTGTTCTTTTTCCTCTAATGG + Intronic
1003826501 6:9958539-9958561 AGTGATCTGTTTTCCCCTATTGG - Intronic
1004840846 6:19583183-19583205 AGTTATGTTTTTTTCCTTCTTGG - Intergenic
1005024962 6:21453771-21453793 AGGCATTTTTATTCCCCTAAAGG - Intergenic
1007198206 6:40081801-40081823 AATTATGCTTTTTCTCCTTAAGG + Intergenic
1008045067 6:46843271-46843293 AGTAATGATTTTGCCCCTCAGGG - Intergenic
1008077303 6:47158744-47158766 AGATGTGATTTTTGCCCTAATGG + Intergenic
1008342089 6:50379517-50379539 TGTTATGATGTTTTCCCTAATGG - Intergenic
1008759882 6:54841270-54841292 TGTTCTGTTTTTACACCTAATGG + Intergenic
1009165339 6:60334364-60334386 AATAATGTTTTTTTTCCTAAGGG + Intergenic
1009243985 6:61212478-61212500 AGCTATAGTCTTTCCCCTAAAGG + Intergenic
1009396885 6:63210134-63210156 AGTTAGGTTCTTAGCCCTAATGG + Intergenic
1009764335 6:68049852-68049874 AATTATGGTTATTACCCTAAGGG - Intergenic
1010451106 6:76004250-76004272 AGTCATATTTTTATCCCTAATGG - Intronic
1010603389 6:77858855-77858877 AATTATTTTTTTTCCATTAAAGG - Intronic
1011728786 6:90238184-90238206 AGATACATTTTTCCCCCTAATGG - Intronic
1012345365 6:98179215-98179237 ATTTATTTGTTTTCCTCTAAGGG + Intergenic
1012541062 6:100362384-100362406 GGTTTTTTTTTTTCCCTTAATGG + Intergenic
1012596047 6:101041747-101041769 AGTTATGTTGTTTCCTTAAAAGG - Intergenic
1012741794 6:103026050-103026072 ACTTATTTTTTTTCTCCTATAGG - Intergenic
1013801715 6:113953436-113953458 AGTTTTGGTTTTTCCTTTAAAGG + Intronic
1014469260 6:121794555-121794577 ATTTATATTTTCTTCCCTAATGG - Intergenic
1015468656 6:133577054-133577076 AGTTATTTTTTTTCCCATAGGGG - Intergenic
1015560004 6:134503836-134503858 AGTTATGTTTTCTTCCCTGAAGG - Intergenic
1015678244 6:135774947-135774969 ATTTATCTTTTTTTCCCTACAGG + Intergenic
1015734166 6:136380022-136380044 AGTTTGTTTTTTTCCCCTAGAGG + Intronic
1015737966 6:136421644-136421666 GGTTATCTTTTATGCCCTAAAGG - Intronic
1017502840 6:155041256-155041278 ATTTTTGTTTTTTCCCCCCAGGG + Intronic
1017782673 6:157728571-157728593 TGTTATCTTTTTCCCCCTCAAGG + Intronic
1018089046 6:160329725-160329747 TGTTTTGTTTTTTCCCTCAAGGG - Intergenic
1018676923 6:166230298-166230320 TGTTTTGTTTTTTCCCTCAAGGG + Intergenic
1019045491 6:169142269-169142291 ATTCATGTTTTTCCCCCTCAAGG + Intergenic
1019045504 6:169142328-169142350 ATTCATGTTTTTCCCCCTCAAGG + Intergenic
1020352044 7:7231412-7231434 AGTTATGTCTCTTCCCTCAAAGG + Intronic
1021468496 7:20973243-20973265 AGGAATTTTTTTTCCCTTAATGG + Intergenic
1021548761 7:21846663-21846685 TGTTTTGTTTTTTCCTGTAATGG + Intronic
1022715768 7:32896762-32896784 AGCAATGTTTTGTGCCCTAAGGG + Intergenic
1023579714 7:41668710-41668732 AGTTGTGATTTTTGCCATAATGG - Intergenic
1023802922 7:43850589-43850611 AATTAGGCTTTTTCCCCTAAGGG - Intergenic
1025153110 7:56575972-56575994 AGTTAAGCTTTTTCCCTGAAGGG + Intergenic
1025626919 7:63231092-63231114 AGTTATGTTGATTTACCTAAAGG - Intergenic
1027480182 7:78686144-78686166 ATTGTTGTTTTTTCCCCTATGGG - Intronic
1027549739 7:79575332-79575354 AGGTATGTTTTTTCTTCTAATGG - Intergenic
1027838473 7:83277765-83277787 AATTTTGTTTTTCCCCCTTAAGG + Intergenic
1028431546 7:90752632-90752654 AGTTATGTTTTTTCTTCTTCTGG - Intronic
1028458710 7:91067209-91067231 AATTATGTTTTTTCATCTAATGG + Intronic
1030020157 7:105266072-105266094 AATTATGTTTTTACCTTTAAAGG - Intronic
1030216416 7:107047559-107047581 ACTCCTGTTTTTTCCCCCAATGG - Intronic
1030622023 7:111800670-111800692 ATTTATCTTTTTTCGCCTAAAGG + Intronic
1030852002 7:114499475-114499497 AGTTATATTTTTACCCCAATGGG - Intronic
1030853307 7:114518356-114518378 TTTTATGTTTTTTCCCCAAGTGG + Intronic
1031218228 7:118926293-118926315 AGGTCTGTTTTTTCCACTCATGG + Intergenic
1031384193 7:121126457-121126479 TTTTATGTTTTTGCCTCTAAGGG - Intronic
1033262639 7:139856953-139856975 GATTATGCTTTCTCCCCTAAGGG - Intronic
1033397756 7:140992203-140992225 AGTCATGTTTTTACCCCTGCTGG + Intergenic
1033842664 7:145394106-145394128 AATTGTGTTTCTTCCCCTAAAGG - Intergenic
1033965815 7:146974095-146974117 AGTTATGTTGTTGCCCTGAAAGG + Intronic
1034011754 7:147536026-147536048 AGATTTGTTTCTTCCCCTACTGG - Intronic
1036809951 8:11861056-11861078 TGTTACGTCTTTGCCCCTAATGG + Intronic
1037039559 8:14213919-14213941 AGTTAAGTTTTTCCACCTTAAGG - Intronic
1037112683 8:15183646-15183668 AGTGATTTTTCTTCCCCAAATGG - Intronic
1037134963 8:15449577-15449599 CATTAGGCTTTTTCCCCTAAGGG - Intronic
1039156728 8:34567540-34567562 AGATATTTTTCTTCCCCTAAAGG + Intergenic
1039253265 8:35689956-35689978 AGCTATGTTATTTCCACTATAGG - Intronic
1039670712 8:39594683-39594705 ATTTGTTTTTTTTTCCCTAATGG + Intronic
1040609020 8:48964107-48964129 AGTTTTCTTTTTTCCCCTATCGG - Intergenic
1041897580 8:62943843-62943865 AGTTATTTTGTTCCCTCTAATGG - Intronic
1042074129 8:64969631-64969653 AGATATCTTTTTTCCTATAAAGG + Intergenic
1042235017 8:66603091-66603113 GGTTATGATTTTTCCCGTAGTGG - Intronic
1043013908 8:74913988-74914010 AGTTATATTTTTTCCCCAAGAGG + Intergenic
1043203395 8:77403718-77403740 AAATATGTTTTTTGCCCTAATGG + Intergenic
1045155578 8:99466163-99466185 ATATATATTTTTTCCCCTATGGG - Intronic
1045875244 8:106974305-106974327 AGGTATGTGTTTTCCCCCAAAGG - Intergenic
1046832250 8:118759515-118759537 AGTTATGTTTTTCCCCCAGATGG + Intergenic
1051263356 9:15287680-15287702 AATCATTTTTTTTTCCCTAAAGG - Intronic
1053023580 9:34712732-34712754 AGTTATTTTTTTTTTCCAAAAGG + Intergenic
1053902902 9:42812794-42812816 AGTAATGATTTTGCCCCTCAGGG + Intergenic
1054767834 9:69057107-69057129 ATTAGTTTTTTTTCCCCTAAGGG - Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055127983 9:72741575-72741597 AGTGATGGTCTTTCCCATAAGGG + Intronic
1056005058 9:82260842-82260864 AGTTTTGTTTTTTCCCCTTTAGG + Intergenic
1057018580 9:91677974-91677996 AGTTCTCTTTTTTCCCTTATTGG + Intronic
1057638420 9:96794274-96794296 AGTTATGTTCTTTTCTATAATGG + Intergenic
1057736950 9:97671453-97671475 TGTTATTTTTTTTCTCCTTAAGG + Exonic
1058348831 9:103997561-103997583 TGTTATTTTTTTTCTCCTACTGG - Intergenic
1058728300 9:107824700-107824722 AATTCTGTATTTTCCCCCAAAGG + Intergenic
1060928561 9:127473183-127473205 AGTTATCTTCTTTCCCCTCATGG - Intronic
1061354019 9:130089572-130089594 TGTTTTGTTTTTTTCTCTAAGGG + Intronic
1061771139 9:132922863-132922885 GGTTTTTTTTTTTCCCCTATCGG - Intronic
1203358168 Un_KI270442v1:182199-182221 AGGTATGTTTTTTCCACCATAGG - Intergenic
1186838690 X:13463595-13463617 ACTTTTGTTTTTTCCTATAATGG + Intergenic
1187497271 X:19806023-19806045 AGGTGTTTTTCTTCCCCTAATGG + Intronic
1188376474 X:29435968-29435990 AGTTATGTTTTTTCCCCTAATGG - Intronic
1188601029 X:31964194-31964216 TTTTATTTTTTTTCCCCTGATGG - Intronic
1189533705 X:41913909-41913931 TGGTATGTGATTTCCCCTAAAGG - Intronic
1189785476 X:44555390-44555412 AGTTAGGCTTTCTTCCCTAAAGG + Intergenic
1189785883 X:44558483-44558505 AGTTAGGCTTTCTTCCCTAAAGG - Intergenic
1190439337 X:50462130-50462152 AGGTATGATTTTTCCCCAGAAGG + Intronic
1192613512 X:72592323-72592345 AGTTATGTTTTTTCCCCTTTGGG - Intronic
1194419811 X:93660162-93660184 AGTTATCTTTTTTCACATTATGG - Intergenic
1194465422 X:94229167-94229189 ATTTACATTTTTTTCCCTAAAGG + Intergenic
1194640091 X:96393377-96393399 AGTGATGTTTTTTCCCATTACGG + Intergenic
1195478790 X:105318985-105319007 AATTATACCTTTTCCCCTAATGG + Intronic
1196487595 X:116231581-116231603 AGTAATGGTTCTTCCCTTAAAGG + Intergenic
1196783396 X:119401961-119401983 AGGAATTTTTTTTCCCCTACAGG + Intronic
1197863672 X:130996160-130996182 ATTTCAGTTTTTTCCCCAAAGGG + Intergenic
1199994477 X:153011964-153011986 AGTCAAGTTTTTTTCCTTAAAGG + Intergenic
1200822675 Y:7603399-7603421 AGTTAAGTTTTATTCACTAAAGG + Intergenic
1201601599 Y:15735228-15735250 ATTTATGTTTTTTACACTACTGG + Intergenic
1202237628 Y:22730620-22730642 AGTTAAGTTTTATTCACTAAAGG - Intergenic