ID: 1188377381

View in Genome Browser
Species Human (GRCh38)
Location X:29448687-29448709
Sequence CAAGTTCTATACTACTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188377381_1188377382 1 Left 1188377381 X:29448687-29448709 CCTATATAGTAGTATAGAACTTG 0: 1
1: 0
2: 1
3: 3
4: 110
Right 1188377382 X:29448711-29448733 CATTTACAGATGTCCTAGCTAGG 0: 1
1: 0
2: 1
3: 21
4: 117
1188377381_1188377385 29 Left 1188377381 X:29448687-29448709 CCTATATAGTAGTATAGAACTTG 0: 1
1: 0
2: 1
3: 3
4: 110
Right 1188377385 X:29448739-29448761 TCCACAACAATACCATAGACTGG 0: 1
1: 0
2: 5
3: 31
4: 343
1188377381_1188377387 30 Left 1188377381 X:29448687-29448709 CCTATATAGTAGTATAGAACTTG 0: 1
1: 0
2: 1
3: 3
4: 110
Right 1188377387 X:29448740-29448762 CCACAACAATACCATAGACTGGG 0: 1
1: 1
2: 20
3: 149
4: 572
1188377381_1188377383 2 Left 1188377381 X:29448687-29448709 CCTATATAGTAGTATAGAACTTG 0: 1
1: 0
2: 1
3: 3
4: 110
Right 1188377383 X:29448712-29448734 ATTTACAGATGTCCTAGCTAGGG 0: 1
1: 0
2: 2
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188377381 Original CRISPR CAAGTTCTATACTACTATAT AGG (reversed) Intronic
901727317 1:11252107-11252129 CAAATACTATGCTACTTTATCGG - Intronic
902055098 1:13594258-13594280 CAAATTCTATACTAGTTTAGAGG + Intronic
909169549 1:72277436-72277458 AAAGATCTATACAACTACATGGG + Intronic
911246574 1:95524987-95525009 CAATTTCCATATTACTATAATGG + Intergenic
911529186 1:99023612-99023634 CAATTTCTATATTAATTTATAGG + Intergenic
911828503 1:102519379-102519401 CAAGTTTTGTATTATTATATTGG - Intergenic
917761094 1:178159048-178159070 CAAGTTATATTTTACTTTATTGG - Intronic
924487416 1:244499225-244499247 TAAGTTCAAAACTACTATAATGG - Intronic
1069672877 10:70224565-70224587 CAAGTTGTTTACTAATAAATAGG + Intronic
1073881276 10:107983239-107983261 CAAGTTATATAATCTTATATAGG - Intergenic
1079829308 11:25242366-25242388 CAAGTCCTATACTAATCTTTTGG + Intergenic
1087339784 11:96889062-96889084 CATGTTATAGACTACAATATAGG - Intergenic
1088673924 11:112172835-112172857 TATGTTATATATTACTATATGGG + Intronic
1088722538 11:112607153-112607175 CAAGCTCTATTCTGCTATAGTGG - Intergenic
1091433608 12:456835-456857 CAAGTCTTATTCTACTCTATAGG - Intergenic
1092680284 12:10971459-10971481 ATAGTACTATACTATTATATAGG + Intronic
1093357116 12:18179575-18179597 CAACTTCCATTCTTCTATATCGG - Intronic
1095364322 12:41384523-41384545 CAAGATCAATTCTACTCTATTGG - Intronic
1095686987 12:45047955-45047977 CATGTTCTGTACTGCTTTATAGG - Intronic
1099059390 12:77887292-77887314 CAATTTCTACACAACTATATAGG + Intronic
1108793569 13:54002878-54002900 TAATTTCTATACTACAAAATGGG - Intergenic
1109698997 13:66000985-66001007 ATAATTCTATACTACCATATTGG - Intergenic
1109938192 13:69322406-69322428 AAATGTCTATGCTACTATATAGG + Intergenic
1110636860 13:77776447-77776469 CAAGTTCTAGACAACTATGGAGG - Intergenic
1112962005 13:105138473-105138495 CAGGTACTATGCTAATATATAGG - Intergenic
1114718102 14:24850060-24850082 AAAGTACTATATTAATATATTGG + Intronic
1119029113 14:71177542-71177564 CAAGTTCTAACCAACTGTATTGG + Intergenic
1120733477 14:88028101-88028123 CAAATTGCATACTACAATATAGG + Intergenic
1121824456 14:96999253-96999275 CAGGTTCTATACTTGTAGATGGG - Intergenic
1126451047 15:48810129-48810151 CAAGTTCATGACTACGATATAGG + Intronic
1126469584 15:48993986-48994008 CATGTTCTATATCAATATATAGG - Intronic
1131842876 15:96456601-96456623 CAAATTTTATACTACTGTAAGGG + Intergenic
1132007605 15:98243510-98243532 CAGGTACTATTCTACTATCTGGG - Intergenic
1135203737 16:20464027-20464049 CAAGTTCTTTGCTAAAATATAGG + Intronic
1135215265 16:20560909-20560931 CAAGTTCTTTGCTAAAATATAGG - Intronic
1135835774 16:25823946-25823968 CAAGTTCTCTACTGCTTTTTAGG - Intronic
1143931035 17:10425290-10425312 GAAGTTAGATGCTACTATATGGG + Intergenic
1144195518 17:12890946-12890968 CAAGTTCTGTATAACTTTATAGG + Intronic
1151046161 17:70922010-70922032 CAAGTTCTATACATTTAGATAGG + Intergenic
1158030401 18:52957292-52957314 AAAGTTATAATCTACTATATTGG - Intronic
1162240252 19:9346928-9346950 CTAGTTCACTACTACTATAGAGG + Intronic
1167209562 19:48125143-48125165 CAAGTCCTATACAACAAAATAGG + Intronic
928711667 2:34013891-34013913 GAAGTTGCATACTAATATATTGG + Intergenic
929406290 2:41646160-41646182 CATGTTCTATGCTACTATTAGGG + Intergenic
936856389 2:116963107-116963129 AAAATACTATACCACTATATTGG + Intergenic
937202529 2:120213895-120213917 AAAGCTCTATATTTCTATATTGG + Intergenic
938234241 2:129690146-129690168 AAAGTTCTATACACATATATAGG + Intergenic
941187452 2:162334739-162334761 CAAGCTCTACACTACTATTGAGG - Intronic
944950488 2:204743416-204743438 CAAGCTCTAAACTAGTATAGAGG + Intronic
946550367 2:220794502-220794524 AAACTTCTATACTTCTATAAGGG - Intergenic
1176961669 21:15165705-15165727 CAAATTCCATGCTACTATCTTGG - Intergenic
1178198566 21:30376997-30377019 CAAGAAATATACTTCTATATAGG + Intronic
961600660 3:128059088-128059110 CAAGTTCCACAGTACTAGATGGG - Intronic
961601164 3:128063215-128063237 CAAGTTCCACAGTACTAGATGGG + Intronic
963583937 3:147160520-147160542 TAAGGTCTATAGTACAATATAGG + Intergenic
967602692 3:191408296-191408318 CAAATCCTCTACTACTTTATTGG + Intergenic
967670773 3:192232647-192232669 CAAGTACTATGCCACTATCTGGG - Intronic
972815914 4:42645388-42645410 TAAATTGTATACAACTATATAGG - Intronic
973898127 4:55437029-55437051 CAAGTTCTAAATTATTATGTAGG - Intronic
974571097 4:63649784-63649806 CTAGTTCTCTACTAATTTATGGG + Intergenic
976421245 4:84846985-84847007 CAAGGTCCCTACTACTATGTGGG + Intronic
976514766 4:85952671-85952693 CAAGTTTGATACTTTTATATAGG + Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978471122 4:109068574-109068596 TATGTTTTAAACTACTATATAGG - Intronic
981755802 4:148140797-148140819 TAAGCTATATATTACTATATTGG - Intronic
982584952 4:157223863-157223885 CAAATGCTAAACTACTGTATTGG + Intronic
983160640 4:164409806-164409828 CAAGTTCTTTACTACAATATAGG + Intergenic
984382373 4:179012100-179012122 CAAACTCTATACTACCATGTAGG - Intergenic
987176723 5:15319197-15319219 AAATTTCTATACTAATTTATGGG + Intergenic
987538399 5:19218503-19218525 CAATTTGTATATTTCTATATAGG - Intergenic
989809443 5:45655742-45655764 GAAGTTGCATGCTACTATATGGG - Intronic
990938299 5:61173996-61174018 CAAGTGCTATACTTCCTTATTGG - Intergenic
991644813 5:68791168-68791190 CGAGTTCTGTACTACCCTATTGG - Intergenic
993018095 5:82559829-82559851 CAAGTAGTATTCTACTTTATTGG - Intergenic
993180173 5:84542377-84542399 CAATTTCTATTGTACTGTATTGG + Intergenic
993725333 5:91360504-91360526 CAAGTTTTAAACTGCAATATTGG + Intergenic
994872633 5:105372570-105372592 CAAGTTCAATATCACTCTATTGG - Intergenic
995911141 5:117188430-117188452 CAAGTTCTATAGCACAATTTTGG + Intergenic
997090014 5:130845775-130845797 CAAGTTCTTTACAACGGTATAGG + Intergenic
1001219502 5:169887929-169887951 CAATTTCTTTTCTACTTTATTGG - Intronic
1005567278 6:27109047-27109069 CAAATCCTATAGTCCTATATAGG + Intergenic
1009338622 6:62525998-62526020 AAAGTTCTCTACTACAATACAGG + Intergenic
1012877984 6:104752194-104752216 CAAGTTTTTCTCTACTATATAGG + Intronic
1013280293 6:108630021-108630043 CCAGTTCTTTTCTACTATATTGG + Intronic
1017603721 6:156110997-156111019 CAGTTACTATACTATTATATAGG + Intergenic
1020160429 7:5766840-5766862 AAAATTCTATACAACTATAAAGG + Intronic
1023309081 7:38864862-38864884 CATTTTCTATACTACCAGATTGG + Intronic
1026646352 7:72173140-72173162 CAATTGCTGTACTTCTATATAGG + Intronic
1028788307 7:94822518-94822540 CAAATACTATACTATTTTATGGG - Intergenic
1030747530 7:113185533-113185555 ACAGTTCTATTGTACTATATGGG + Intergenic
1032925309 7:136597881-136597903 TAAGATTTTTACTACTATATAGG + Intergenic
1036583403 8:10099884-10099906 CAAGTCCTAAAGTACAATATGGG - Intronic
1036983179 8:13494544-13494566 GAAGTTCTGAACTAATATATAGG - Intronic
1037239137 8:16757868-16757890 CAAGTTCTAGCCTTCTCTATGGG + Intergenic
1037744841 8:21634708-21634730 CAAGTTCTTTGCAACTTTATAGG - Intergenic
1038921858 8:32093539-32093561 CAAGTTCTTTTTCACTATATAGG + Intronic
1042823608 8:72957990-72958012 CAATTTCTATACTATAAAATGGG - Intergenic
1043084742 8:75815038-75815060 CAACTTCTATACTAATATTTTGG - Intergenic
1044172540 8:89072682-89072704 CATGTTCATTGCTACTATATAGG - Intergenic
1044677001 8:94739189-94739211 TAACTTCTATTCTGCTATATTGG + Intronic
1045430503 8:102109589-102109611 CAAGTGATATACTAATATTTGGG + Intronic
1048661472 8:136607441-136607463 CAAATTCTAAAATACTTTATGGG + Intergenic
1050450621 9:5777978-5778000 CAATTTCTATACTAAAATAAAGG + Intronic
1050520238 9:6489673-6489695 GAAGTGCTATACTACTAAAGAGG - Intronic
1050527381 9:6557802-6557824 CATGTCCTATATTACTATAATGG + Intronic
1052333981 9:27300976-27300998 CAAGTCCTAGATTAATATATTGG - Intergenic
1055317113 9:75044979-75045001 CAAATTCTAATCAACTATATAGG - Intergenic
1186371391 X:8951045-8951067 TCAGTTTTATACTACTATTTTGG + Intergenic
1188377381 X:29448687-29448709 CAAGTTCTATACTACTATATAGG - Intronic
1193380663 X:80812733-80812755 CAAGATCAATACTAATAAATGGG + Intergenic
1193574582 X:83182903-83182925 CCAGTTCTATTCTCCTATCTAGG - Intergenic
1197505785 X:127302699-127302721 TAAATATTATACTACTATATAGG - Intergenic
1197697958 X:129571117-129571139 CAAGTTCTATAGAATTATAGAGG - Intronic
1201153613 Y:11109257-11109279 ATAGTTCTTTACAACTATATAGG + Intergenic
1201719804 Y:17084081-17084103 CAATTTCTCTTCTACTATGTGGG + Intergenic