ID: 1188378589

View in Genome Browser
Species Human (GRCh38)
Location X:29463965-29463987
Sequence ACATAAAGACTGGACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188378589_1188378595 20 Left 1188378589 X:29463965-29463987 CCAGCCCAGTCCAGTCTTTATGT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 1188378595 X:29464008-29464030 TTTAACTCCAGTCCCCTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188378589 Original CRISPR ACATAAAGACTGGACTGGGC TGG (reversed) Intronic
901336073 1:8450473-8450495 ACGTCTAGTCTGGACTGGGCTGG - Intronic
902255627 1:15187042-15187064 ACACAAAACCTGCACTGGGCCGG + Intronic
902839155 1:19064564-19064586 ATATACAGACTTGACTGGCCAGG - Intergenic
903788768 1:25878433-25878455 ACAAAAAGACTGGGGTGGGGTGG - Intergenic
905483325 1:38276510-38276532 AGATATAGACTGGGCTGGACAGG - Intergenic
909737082 1:78975042-78975064 ACAAACAGACTGTAGTGGGCAGG + Intronic
914794212 1:150906318-150906340 ACAAAAAGAATGAACTGGGAGGG + Intergenic
915504614 1:156345896-156345918 AGAAAAAGAATGGACTGGCCAGG + Intronic
916275601 1:162990110-162990132 ACAGCAAGACTGGAGTGGGGAGG - Intergenic
920533701 1:206723557-206723579 ACATGAAGACAAGACTGGGAAGG - Intronic
921905109 1:220487857-220487879 AAATAAAAACTGGAGTGTGCAGG + Intergenic
924921079 1:248629705-248629727 ACAGACAGACTGGAGTCGGCGGG - Intergenic
1064546419 10:16454931-16454953 ACCTAAAGACTAAACTGGCCAGG + Intronic
1065215429 10:23443790-23443812 ATTTAAAAACAGGACTGGGCAGG - Intergenic
1065640655 10:27778654-27778676 CCATTAAGGCTGGACTTGGCTGG + Intergenic
1065655131 10:27940747-27940769 TCATACAGACTCGATTGGGCAGG + Exonic
1066698081 10:38095888-38095910 CCAAAAAAACTGGGCTGGGCTGG + Intronic
1067359255 10:45562143-45562165 ACATAAAGAATAGACTGAGATGG + Intronic
1067549592 10:47225176-47225198 AAATATTGACTGGGCTGGGCAGG - Intergenic
1069449566 10:68505476-68505498 ACATAAAGAATTTACTTGGCCGG + Intronic
1071080778 10:81807304-81807326 ACAGAATGACTAGAGTGGGCTGG - Intergenic
1076293119 10:129362779-129362801 ACATAAAGAAGGCAGTGGGCTGG - Intergenic
1076548876 10:131264516-131264538 ACCTGAAGGCTGCACTGGGCAGG + Intronic
1077331957 11:1987765-1987787 GCAGACAGACTGGGCTGGGCTGG - Intergenic
1078262141 11:9719733-9719755 AAATAAAAACTGTACTTGGCAGG - Intronic
1078746271 11:14118565-14118587 TCAGAAAGACTGGGCTGGGAAGG + Intronic
1078782382 11:14451540-14451562 AAGAAAAGACTGGACTGGACTGG + Intronic
1079252925 11:18800646-18800668 ACATGAAGAATGGACTGGAGGGG + Intergenic
1080504962 11:32903476-32903498 ACAAACAAAGTGGACTGGGCAGG + Intronic
1081610778 11:44562058-44562080 ACAAAAAAACTGGCTTGGGCTGG - Intergenic
1083257205 11:61504023-61504045 ACAGAAAGTAAGGACTGGGCAGG - Intergenic
1085329307 11:75634563-75634585 TCATAAAGATTAGACTTGGCTGG - Intronic
1085731064 11:78999220-78999242 AGATAAACAATGGGCTGGGCGGG + Intronic
1088910947 11:114192114-114192136 ATCTGAAGACTCGACTGGGCTGG + Intronic
1089091749 11:115883861-115883883 GCATGAAGAATGGACTGGACTGG - Intergenic
1089965739 11:122654020-122654042 GCAAAAAGACAAGACTGGGCTGG - Intergenic
1090549602 11:127805734-127805756 TCATAAATACTGGGCTGGGATGG + Intergenic
1090682192 11:129072978-129073000 ACACGATGACTGGAGTGGGCTGG - Intronic
1202814938 11_KI270721v1_random:42941-42963 GCAGACAGACTGGGCTGGGCTGG - Intergenic
1091768447 12:3136942-3136964 ACAGCAGGACTGGACGGGGCAGG - Intronic
1091993950 12:4978305-4978327 ACAAAAAGACTGGATTGGCTGGG - Intergenic
1092132178 12:6120293-6120315 ACAAAAAAACTGGACTAAGCAGG - Intronic
1097674802 12:62588594-62588616 ATGTAAAGAATGGACTGGACAGG - Intronic
1098021341 12:66159410-66159432 ACATGAAGGCTTGACTGGGCTGG - Intronic
1100725561 12:97404952-97404974 ACAGAAAGAATGGGCTTGGCAGG + Intergenic
1101126139 12:101635242-101635264 ACATAATGACAGGAAGGGGCTGG - Intronic
1101366919 12:104081053-104081075 ACATAAAGCCTACACTGGGCAGG - Intronic
1103157859 12:118702265-118702287 ACATTAAGACTGGAATTGCCAGG + Intergenic
1105671595 13:22623700-22623722 ACAGAAAGGTTGGAGTGGGCTGG + Intergenic
1106236162 13:27862307-27862329 TCATAAAAACAGGAGTGGGCTGG + Intergenic
1107419626 13:40234390-40234412 ACCTAAAGAGTGGACTGTGCGGG + Intergenic
1108829587 13:54460959-54460981 ACAGAAAGACTGGGCTCAGCTGG - Intergenic
1109268173 13:60224594-60224616 TCAAAAAGACTGGAGTGGCCAGG - Intergenic
1109570945 13:64188886-64188908 ACATAATGATTGGCTTGGGCAGG + Intergenic
1110607199 13:77446685-77446707 CCATATAGAATGGATTGGGCTGG + Intergenic
1112311242 13:98319116-98319138 AAACAAAAACTGGACGGGGCTGG - Intronic
1112788828 13:102981293-102981315 ACATAAAGAGGGGAGTGGGCAGG - Intergenic
1113170995 13:107503163-107503185 CCTTAAAGAATGAACTGGGCAGG - Intronic
1115195983 14:30799798-30799820 ACCTGAAGACTTGACTGGGCTGG - Intergenic
1116457833 14:45139770-45139792 AGTTCAAGACTGGCCTGGGCAGG + Intronic
1120001443 14:79307595-79307617 ACCTGAAGCCTTGACTGGGCTGG + Intronic
1121156966 14:91694870-91694892 ACATAACTACTGGGCTGGGGAGG + Intronic
1121208023 14:92185836-92185858 AAATAAAGACTTAACTTGGCCGG + Intergenic
1122282201 14:100629978-100630000 ACATGGAGACGGGACAGGGCAGG - Intergenic
1122563157 14:102631497-102631519 AAAAATAGTCTGGACTGGGCCGG - Intronic
1124495153 15:30181772-30181794 TCATAAAGACAGGACTGAGATGG - Intergenic
1124748414 15:32356873-32356895 TCATAAAGACAGGACTGAGATGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1128122036 15:65157432-65157454 AGATTAAGACAGGACAGGGCAGG - Intronic
1128166066 15:65465850-65465872 ACATAAATAATGGACTGGGCTGG - Intronic
1128552469 15:68607258-68607280 ACTTGAAGGCTGGACTGGGCTGG + Intronic
1130948839 15:88569894-88569916 ACATAAAGACCTTACTGAGCTGG - Intergenic
1133243556 16:4431227-4431249 AGAGAGAGGCTGGACTGGGCCGG + Intronic
1133931626 16:10237351-10237373 ACAAAAAGTCTTGGCTGGGCTGG - Intergenic
1136160992 16:28418623-28418645 AAAAAAAGACTTGAATGGGCAGG - Intergenic
1136201972 16:28696378-28696400 AAAAAAAGACTTGAATGGGCAGG + Intronic
1136218314 16:28810557-28810579 AAAAAAAGACTTGAATGGGCAGG + Intergenic
1136916100 16:34199421-34199443 ACATAAAAACTACACAGGGCCGG - Intergenic
1137441110 16:48499107-48499129 AGATAAAGTCAGGACAGGGCAGG - Intergenic
1140095162 16:71868955-71868977 AAAAAAAAACTGGACTGGCCAGG - Intronic
1141322908 16:83028482-83028504 ACATGAAAACAGGACTGAGCAGG + Intronic
1141561092 16:84868143-84868165 ACAGAAAGACTGGTGGGGGCAGG - Intronic
1143949197 17:10619402-10619424 ACAAAAAAAGTGGCCTGGGCCGG - Intergenic
1148027366 17:44598048-44598070 ACATAAAGGCTGGGCTGGATTGG + Intergenic
1148167861 17:45496147-45496169 ACCTCAAGAATGGACAGGGCTGG - Intergenic
1148645466 17:49217645-49217667 AGATAAAGACTGGGCTGGGGGGG - Intronic
1149567748 17:57651982-57652004 ACACAAAGACAGGAGTGGGAAGG - Intronic
1149715977 17:58790772-58790794 ATCTAAAGGCTGGACTGGACTGG - Intronic
1150399039 17:64842559-64842581 ACCTCAAGAATGGACAGGGCTGG - Intergenic
1151087471 17:71397534-71397556 ATATAAAGACTGAACAGGCCAGG + Intergenic
1153938325 18:9952274-9952296 ACAAAAAAGCTGGGCTGGGCGGG + Intronic
1154959880 18:21297545-21297567 ACATATAGAATGGACTGTGTTGG + Intronic
1158912958 18:62086320-62086342 ATAAAAAGCCTGAACTGGGCCGG + Intronic
1159373351 18:67558937-67558959 ACATAAAGGCTAGAGAGGGCTGG + Intergenic
1162361081 19:10220993-10221015 GCATAAAGACTTGACTGCTCAGG - Intronic
1165365312 19:35361745-35361767 TTATACAGACTGGGCTGGGCTGG - Intergenic
1165374029 19:35428948-35428970 ACATACGTACTGGGCTGGGCTGG - Intergenic
1165399853 19:35591813-35591835 TCTTAAAGATTGGAGTGGGCCGG + Intergenic
1165745451 19:38227926-38227948 ACAGTAAGCCTGGACTGGGAGGG - Intronic
1165769534 19:38370869-38370891 ACAGAAAGAGAGGCCTGGGCTGG - Exonic
1165816350 19:38644833-38644855 AAAAAAACACTGGGCTGGGCTGG + Intergenic
1166329137 19:42068821-42068843 AGATAGAGACTGGACGGGGTGGG + Intronic
1167411415 19:49346358-49346380 ACATAAATACAGGACTTGGACGG + Intronic
1167832852 19:52040607-52040629 ACAGACACACTGGATTGGGCTGG + Intronic
926209888 2:10862052-10862074 ATGTAAAGACTGCACTGGGGAGG - Intergenic
928543661 2:32308745-32308767 ACAAAAAAACAGAACTGGGCCGG + Exonic
929242520 2:39666505-39666527 AGATAAAGACTGGAGGCGGCGGG - Intronic
929933708 2:46277833-46277855 ACACAAAGAGTGTGCTGGGCTGG + Intergenic
931449764 2:62358876-62358898 ACATAAAAACAGGATTGGCCGGG - Intergenic
931807940 2:65826102-65826124 AAAGAATGGCTGGACTGGGCTGG + Intergenic
933739031 2:85518414-85518436 AAATAAAAACTAGGCTGGGCGGG - Intergenic
935065159 2:99641069-99641091 ACAGAAGGAATGGCCTGGGCAGG - Intronic
935403157 2:102681366-102681388 ATTTAAAGACAGTACTGGGCCGG - Intronic
937061314 2:118982302-118982324 GCATAAGGGCTGGACTAGGCAGG - Intronic
939591795 2:144073564-144073586 ACAGAAAGACATGAGTGGGCAGG + Intronic
942793941 2:179793805-179793827 ACAGAAATACTGGAGTTGGCAGG + Intronic
943393088 2:187295516-187295538 AAATAAACACAGAACTGGGCTGG - Intergenic
943838618 2:192549330-192549352 TCATAAAGACTGGAGTGCACTGG + Intergenic
944306370 2:198184484-198184506 ATCTAAAGACCTGACTGGGCTGG + Intronic
946106641 2:217376133-217376155 TCATCAAGGCTGGACTGGGATGG - Intronic
946895027 2:224315037-224315059 ATCTGAAGACTTGACTGGGCTGG - Intergenic
947042893 2:225944010-225944032 ATCTAAAGACTTGACTGGGGAGG - Intergenic
948547418 2:238742752-238742774 ACCTAAAGGCTTGACTGGGCTGG + Intergenic
1168865214 20:1080479-1080501 ACTCAAAGGCTGGACTCGGCTGG + Intergenic
1169314238 20:4575179-4575201 AAATAAATATTGGACTAGGCTGG + Intergenic
1171963008 20:31508697-31508719 ACAAAAAGACTGGACTCAGCTGG + Intergenic
1172247074 20:33453039-33453061 ATTGAAAGAGTGGACTGGGCCGG - Intergenic
1173526656 20:43738131-43738153 AGATAAAGACTGAGCTGGCCTGG + Intergenic
1173704092 20:45097562-45097584 ACGTTAAGCCTGGACTCGGCAGG + Intronic
1174356803 20:50004092-50004114 ACATTAAAACTGGGCTGGGTGGG - Intergenic
1175188558 20:57196204-57196226 AGATGAAGACTGGTTTGGGCTGG - Intronic
1178983042 21:37281345-37281367 AGTTAAAGACTAGCCTGGGCAGG - Intergenic
1180690919 22:17714856-17714878 ACATAAAGAGTGTTCTGGCCGGG + Intronic
1182457879 22:30463466-30463488 ACTTAAGGCCTGGACTGTGCTGG + Intronic
1183632536 22:39041998-39042020 ACACAGAGACTGGACAGGGCTGG + Intronic
1183638361 22:39078400-39078422 ATACAGAGACTGGACAGGGCTGG + Intronic
1183712234 22:39511961-39511983 ACATGAAGACGGGCCTGAGCCGG + Exonic
949963149 3:9331442-9331464 ACATAAAGACTCAGCTGAGCTGG + Intronic
951304270 3:21039213-21039235 AGATAAAGAATGGACTGTGAGGG - Intergenic
953945150 3:47140563-47140585 ACAGAAAGAGTTGACTGGCCAGG + Intronic
955736161 3:62040736-62040758 ACTTAAAAGCTGGACTCGGCTGG - Intronic
957301304 3:78394679-78394701 ACATAAAGATTGGAGAGGACTGG - Intergenic
962405028 3:135093251-135093273 ACAGAAAGGCTGGACTTGACTGG + Intronic
963923113 3:150924847-150924869 ACAGAAAGACTGGGCGGGACTGG - Intronic
969466586 4:7360874-7360896 GCATGAAGAAGGGACTGGGCGGG - Intronic
969913391 4:10465843-10465865 AAAGAAAGACTGGGCAGGGCTGG + Intergenic
969988123 4:11232708-11232730 AAACAAAGATTGGACTGGACAGG - Intergenic
972145732 4:36022395-36022417 ACATAACGGCAGGACTTGGCAGG + Intronic
973540867 4:51934293-51934315 TGATAAGGAGTGGACTGGGCTGG - Intergenic
973880754 4:55269065-55269087 TCATAAAGACTGGAGGGGGCTGG + Intergenic
974348285 4:60710944-60710966 AAATAAAGACTAAATTGGGCAGG - Intergenic
974615555 4:64274821-64274843 AAATAAAGACTGGACCCGGTTGG - Intergenic
974897844 4:67960792-67960814 ACAAAAAGATAGTACTGGGCAGG - Intronic
975766107 4:77669224-77669246 ACATTAAGAATGTATTGGGCCGG - Intergenic
975813896 4:78197643-78197665 GCGTAAAGAGTGGACTGGGCTGG + Intronic
975879699 4:78889294-78889316 ACATAAATATTGGACTGGTTTGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979628733 4:122876634-122876656 AAGTAGAGACTGGATTGGGCTGG + Intronic
980228727 4:130020400-130020422 ACATAAAGCCAGGTCTGGACTGG + Intergenic
981213859 4:142139596-142139618 AATTAAAGACTGGGCCGGGCAGG - Intronic
982283962 4:153715376-153715398 ACAGGAAGACTCGACTGGGCTGG + Intronic
983470901 4:168153046-168153068 AGTTCAAGACTAGACTGGGCAGG - Intronic
984460278 4:180027000-180027022 ACAAAAAGACTGTACTGTACAGG + Intergenic
987774011 5:22341199-22341221 ACATAAAGAATGGTCAGGCCAGG + Intronic
989024891 5:37055853-37055875 AAATAAAAACTGGACAGGCCTGG + Intronic
989237926 5:39170849-39170871 ACAGAAAGACTTGGATGGGCTGG - Intronic
992025363 5:72664317-72664339 TCATAAAGAATGGATTAGGCTGG + Intergenic
992025419 5:72664645-72664667 AAAAAAAGAATGGACTAGGCTGG + Intergenic
992525166 5:77602434-77602456 ACATAAAGAGTAGAATGGGCTGG - Intronic
992667913 5:79029397-79029419 ATGTAAAGGCTGGACTTGGCAGG + Intronic
993654601 5:90562170-90562192 ACATAAAGTCTGAACTGCCCAGG - Intronic
995741050 5:115356075-115356097 ATCTGAAGACTGGACTGGGCTGG - Intergenic
997437777 5:133887442-133887464 ACCTGAACACTGGACTGGGGAGG + Intergenic
997944408 5:138186465-138186487 ACATATACACTGGAGTGGGCTGG - Intronic
998198198 5:140094748-140094770 ACATAAAAACTGAGATGGGCTGG - Intergenic
998506545 5:142677018-142677040 GCAAAAAGCCTGGACTGGCCCGG + Intronic
1001335007 5:170789711-170789733 AGATAAAGGCTGGGCTGGGAAGG - Intronic
1001379625 5:171295546-171295568 ACAGAAAGACTGAAATGGGAGGG - Intronic
1003893598 6:10585690-10585712 TCCTAGAGGCTGGACTGGGCTGG + Intronic
1004180591 6:13377731-13377753 ACACAATGAGTGGACGGGGCTGG - Intronic
1004612654 6:17259287-17259309 ACACCAAGACTGGACTGAGATGG - Intergenic
1007336530 6:41158831-41158853 CCATCAAGGGTGGACTGGGCAGG - Intronic
1010704822 6:79095292-79095314 ACATGAAGACTGGGCTCAGCTGG - Intergenic
1013583279 6:111556828-111556850 ATATAAGAGCTGGACTGGGCTGG + Exonic
1013683310 6:112549200-112549222 ACCTAAAGAATGCACTAGGCTGG + Intergenic
1013697830 6:112724975-112724997 ACATAAAGAATGGATTGGAGAGG - Intergenic
1017027326 6:150192777-150192799 ATCCGAAGACTGGACTGGGCTGG + Intronic
1017072274 6:150586264-150586286 ACTTAATGAATGCACTGGGCTGG + Intergenic
1018298720 6:162377300-162377322 ACAGACAGAGAGGACTGGGCTGG + Intronic
1018523281 6:164677569-164677591 AAATAAAAATTGGAATGGGCTGG + Intergenic
1018627383 6:165792691-165792713 ACTTGAAGAGAGGACTGGGCTGG - Intronic
1018702878 6:166441406-166441428 CCCTAAAGACAGGACTGGCCTGG + Intronic
1019141116 6:169943871-169943893 ACAGGATGACTGGATTGGGCTGG - Intergenic
1019398930 7:839848-839870 ACCTAAAGAATGAACTGGGCCGG - Intronic
1020629234 7:10620624-10620646 ACATAAAGACTGAAATCAGCTGG + Intergenic
1020869016 7:13604507-13604529 ACATGAAGACTGGATGGGGCTGG + Intergenic
1023086828 7:36579272-36579294 ACCTAATGGCTGGGCTGGGCTGG - Intronic
1024962969 7:54996815-54996837 ACATAGAGAATGAACTGGGGGGG - Intergenic
1025016639 7:55444369-55444391 ACATGAAGAATGTACTGGGTTGG - Intronic
1025834429 7:65081492-65081514 ACATAAATACTGTGCTGGGTGGG - Intergenic
1025904195 7:65771011-65771033 ACATAAATACTGTGCTGGGTGGG - Intergenic
1026868629 7:73837515-73837537 ACAGAAAGACTGCCCTGGGAAGG - Intronic
1029130847 7:98329674-98329696 ACAGGAAGACTGGAGGGGGCTGG - Intronic
1029172823 7:98642920-98642942 TCCTGAAGACTGGACTGGGTGGG + Intergenic
1029970315 7:104782106-104782128 AGCTAATGACTGGGCTGGGCTGG + Intronic
1031297152 7:120015076-120015098 ACAGAAAAACTGCAGTGGGCAGG + Intergenic
1033439340 7:141364738-141364760 ACCCAAAGAATGGAGTGGGCTGG + Intronic
1034359871 7:150485489-150485511 ACATAAAGAATGGAGTCGGTTGG - Intergenic
1038289325 8:26234879-26234901 AAATTAAGACTGTAGTGGGCTGG - Intergenic
1040142853 8:43946086-43946108 ACTTAAAAACTAGACAGGGCCGG + Intergenic
1040271516 8:45952283-45952305 ACTTAAAAACTAGACAGGGCCGG + Intergenic
1040693376 8:49966689-49966711 TCAAAAAGACTGGAATAGGCTGG - Intronic
1041378582 8:57227445-57227467 ACAAAAAGCCTGGCCTGGGCAGG + Intergenic
1044335193 8:90974453-90974475 ACTTAAAGGCTTGACTGGACTGG - Intronic
1046118348 8:109812547-109812569 ACCTAAAGACTTGACTGAGTTGG + Intergenic
1048068800 8:131000302-131000324 AAATAAATACTGGACAAGGCAGG + Intronic
1048399155 8:134047572-134047594 AGATAAAGACTAGAATGAGCTGG - Intergenic
1051756002 9:20401522-20401544 ACACAAAGACAGGAAGGGGCTGG - Intronic
1052794884 9:32914193-32914215 GGATAAAGACTGGGCTGGTCTGG + Intergenic
1062140924 9:134958572-134958594 ATCTGAAGACTGGACTGGGATGG + Intergenic
1188208688 X:27392902-27392924 ACATAAAGAATGGATTGGCTGGG + Intergenic
1188378589 X:29463965-29463987 ACATAAAGACTGGACTGGGCTGG - Intronic
1189671021 X:43408732-43408754 AAATATAGGCTGGACTGAGCTGG - Intergenic
1189756967 X:44282305-44282327 ACTAAAACACAGGACTGGGCCGG + Intronic
1193109292 X:77711536-77711558 ACATAAAAAGTCAACTGGGCTGG + Intronic
1196202744 X:112903981-112904003 ACACAATGGCTAGACTGGGCTGG - Intergenic
1196312277 X:114183168-114183190 ACTTGAAGTATGGACTGGGCTGG + Intergenic
1198103376 X:133440737-133440759 ACAGAAATACTGTACGGGGCGGG - Intergenic
1198410972 X:136367512-136367534 ACAAAAACACTGCACTGGGTTGG + Intronic
1202202948 Y:22373658-22373680 ACAATAAGACAGGAGTGGGCTGG - Intronic