ID: 1188378931

View in Genome Browser
Species Human (GRCh38)
Location X:29467603-29467625
Sequence AGTACCACGTAGTACCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188378925_1188378931 12 Left 1188378925 X:29467568-29467590 CCGGCAGGAATGAACCTTGTACT 0: 1
1: 1
2: 3
3: 17
4: 107
Right 1188378931 X:29467603-29467625 AGTACCACGTAGTACCTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1188378928_1188378931 -2 Left 1188378928 X:29467582-29467604 CCTTGTACTGGCCTGTGGCAGAG 0: 1
1: 2
2: 3
3: 16
4: 203
Right 1188378931 X:29467603-29467625 AGTACCACGTAGTACCTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1188378922_1188378931 29 Left 1188378922 X:29467551-29467573 CCAAGTGCCTTTGGGCACCGGCA 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1188378931 X:29467603-29467625 AGTACCACGTAGTACCTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1188378924_1188378931 22 Left 1188378924 X:29467558-29467580 CCTTTGGGCACCGGCAGGAATGA 0: 2
1: 1
2: 9
3: 23
4: 103
Right 1188378931 X:29467603-29467625 AGTACCACGTAGTACCTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188378931 Original CRISPR AGTACCACGTAGTACCTGGA AGG Intronic
917876741 1:179293371-179293393 AGTTCTACGTTGTTCCTGGATGG + Intergenic
918371998 1:183870233-183870255 ACTGCTACGTAGTACCTGGACGG + Intronic
924151520 1:241134994-241135016 ACTGCTACGTAGTACCCGGACGG - Intronic
924406141 1:243748897-243748919 AGTACCAAGTAGTACTTCAATGG - Intronic
1063020966 10:2127257-2127279 TGTACCACGCAGTAACTGGTGGG + Intergenic
1069552282 10:69372956-69372978 AGAATCACGTAGAACCTGGGAGG - Intronic
1070846776 10:79529279-79529301 AGAACCTCTTAGAACCTGGAAGG + Intergenic
1076631458 10:131854643-131854665 GGTCCCAGGTAGTTCCTGGAGGG - Intergenic
1081600081 11:44486875-44486897 ACTGCTACGTAGTACCCGGATGG - Intergenic
1083430528 11:62611844-62611866 AGTACCATGGAGTACCGGGGGGG + Intronic
1086527930 11:87750859-87750881 ATTAGCACATAATACCTGGAAGG - Intergenic
1088811320 11:113394772-113394794 ACTACCACTTACTATCTGGATGG - Intronic
1098979197 12:76936737-76936759 ACTGCTACGTGGTACCTGGATGG - Intergenic
1100482061 12:94988697-94988719 ACTGCTACATAGTACCTGGACGG - Intronic
1107176556 13:37406208-37406230 ACTACCAGGTAGTACCAGGCTGG + Intergenic
1120887879 14:89466104-89466126 AATACCAGGAAGTTCCTGGAGGG - Intronic
1125739220 15:41950270-41950292 AGTACCAGGTGATACCTGGAGGG - Intronic
1126848882 15:52785749-52785771 AGCAGCAAGTAGTACATGGAGGG + Intronic
1128242506 15:66110575-66110597 AGGACCTAGTAGTACCTGCAAGG + Intronic
1129488717 15:75903338-75903360 AGTACTACCTAGTCCCTGCAAGG + Intergenic
1136748545 16:32613569-32613591 AGGATTACGTAGCACCTGGAAGG - Intergenic
1137300918 16:47146584-47146606 AGTCCCATGTAGTACTTGAATGG + Intergenic
1158858980 18:61573416-61573438 AGTCCCACTGTGTACCTGGAAGG - Intergenic
926278716 2:11426425-11426447 ACTGCTACGTAGTACCCGGAAGG - Intergenic
930533044 2:52614108-52614130 ACTGCTACCTAGTACCTGGATGG - Intergenic
935719630 2:105968562-105968584 ATTGCTACGTAGTACCCGGATGG + Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
945909751 2:215635309-215635331 TGTTCCAAGTAATACCTGGATGG - Intergenic
1172448564 20:35005963-35005985 AGTGCCTCTTAGTACCTGGGTGG - Intronic
1174854030 20:54025737-54025759 AGTACCACATTGTACATGGCTGG - Intronic
953064826 3:39459295-39459317 ACTGCTACGTGGTACCTGGATGG - Intergenic
962325523 3:134428834-134428856 AGTCCCACGGTGGACCTGGATGG + Intergenic
965871790 3:173274246-173274268 ACTGCTACGTAGTACCTGGACGG - Intergenic
969965742 4:10993683-10993705 AGTCCCAGGTATTCCCTGGATGG + Intergenic
971094690 4:23387444-23387466 AGAGCCAGGTAGTACCTAGAAGG - Intergenic
971812344 4:31442273-31442295 ACTGCTACGTTGTACCTGGATGG - Intergenic
972224931 4:37001888-37001910 ACTGCTACGTTGTACCTGGATGG - Intergenic
974958403 4:68671930-68671952 ACTGCTATGTAGTACCTGGATGG - Intergenic
976299522 4:83505090-83505112 ACTGCTACGTCGTACCTGGATGG + Intronic
980687536 4:136249291-136249313 AATACCACCTAGTAACTGAAAGG - Intergenic
981062137 4:140436397-140436419 AGTACCACCTGGTTTCTGGATGG + Intergenic
984138945 4:175977937-175977959 AGGACCACATAGTATTTGGAGGG - Intronic
986334112 5:6740400-6740422 AGTACCTCATAGTCCCTGGGGGG - Intronic
988878703 5:35476064-35476086 AGTTTCATGTAGAACCTGGAAGG + Intergenic
989003443 5:36784161-36784183 ACTGCTACGTAGTACCCGGACGG - Intergenic
995086577 5:108118022-108118044 ATTACCACATAATACCTGGCAGG + Intronic
1006021215 6:31118674-31118696 TGTAACACGTGGGACCTGGAGGG - Intronic
1008892127 6:56507232-56507254 AGGACCAGGTAGGACCTGTAAGG + Intronic
1009950935 6:70394798-70394820 ACTGCTACGTGGTACCTGGACGG - Intergenic
1016291939 6:142536670-142536692 ACTGCTACGTAGTACCCGGATGG - Intergenic
1022759856 7:33336107-33336129 AATGCCAAGTAGTAGCTGGAAGG + Intronic
1037791021 8:21941795-21941817 AGTCCCAGCTAGTACTTGGAAGG - Intronic
1039847139 8:41333636-41333658 AGTCCCACCTCCTACCTGGAGGG - Intergenic
1043857402 8:85277811-85277833 ACTGCTGCGTAGTACCTGGACGG + Intronic
1047210539 8:122836657-122836679 ACTGCTACGTTGTACCTGGATGG + Intronic
1048716924 8:137281487-137281509 ACTGCTACGTTGTACCTGGATGG - Intergenic
1061158568 9:128880164-128880186 AGGCCCACGGAGTACCTGGCAGG + Intronic
1062383931 9:136301095-136301117 TGGACCACGTAGCACCAGGAAGG + Intronic
1062726418 9:138076499-138076521 AGTAACAGGCAGAACCTGGAGGG + Intronic
1188378931 X:29467603-29467625 AGTACCACGTAGTACCTGGAAGG + Intronic
1189274887 X:39778457-39778479 AGTCCCACTGAGGACCTGGAGGG - Intergenic
1193721533 X:84992294-84992316 AGTACCACCTACTAGCTGGGAGG + Intergenic
1195213543 X:102673822-102673844 AATAACACTTAGTACCTTGATGG + Intergenic
1199065081 X:143406520-143406542 ACTACCAAGTAGAACCAGGATGG - Intergenic
1201348812 Y:13015996-13016018 AGAACCACTTAGAAACTGGAAGG - Intergenic