ID: 1188381408

View in Genome Browser
Species Human (GRCh38)
Location X:29497448-29497470
Sequence TCTTCCATGTAGGAGCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188381408 Original CRISPR TCTTCCATGTAGGAGCTACA TGG Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
903957888 1:27037668-27037690 GCTTCCATGTGGGAGCCACCTGG + Intergenic
904017825 1:27436640-27436662 TCTTCCTTGTAGTTGCTGCATGG - Intronic
905465645 1:38151198-38151220 TCTTCCATGTTGCTGTTACAGGG + Intergenic
906666211 1:47623902-47623924 TCTTCCATTTAGTAACTACATGG - Intergenic
906867490 1:49438444-49438466 TCTTCCATAAAGAAGATACAAGG - Intronic
907945988 1:59137192-59137214 TTCTCCATGTGGCAGCTACAGGG + Intergenic
908388371 1:63663409-63663431 TCTGCCATGTAGGAGTTCCCAGG - Intergenic
909357798 1:74729209-74729231 TCTATCATGTGGGAGCCACATGG + Intronic
910906925 1:92191190-92191212 TCGTGCATGTGGTAGCTACAGGG - Intergenic
913449142 1:118980647-118980669 TCTTCCATGTAGAAAGTAAACGG - Intronic
920590580 1:207214933-207214955 TAGTTCAAGTAGGAGCTACAGGG - Intergenic
923033476 1:230267819-230267841 TCTTGGATGGAGGAGCTACAAGG - Intronic
1063186634 10:3657820-3657842 TGTTCCATGTAAAAGCTTCATGG + Intergenic
1063731881 10:8707134-8707156 ACCACCATGTAGCAGCTACATGG + Intergenic
1064112913 10:12553893-12553915 TCTGCCACATAGGAGCTGCAAGG - Intronic
1066070309 10:31801949-31801971 GCTTCCATGTTTGAGCTACTGGG - Intergenic
1067212016 10:44267264-44267286 TCTTCCAGTTAGGAGGCACAGGG - Intergenic
1068546202 10:58348186-58348208 TCTTCCAGGAAGAATCTACATGG + Intronic
1068602666 10:58971985-58972007 TCTTACAGGAAAGAGCTACATGG + Intergenic
1070648960 10:78221348-78221370 TCTTCGAGGTAGGAACTTCAGGG - Intergenic
1074348128 10:112708456-112708478 TCTTCTATGTAAGAAATACATGG - Intronic
1076422003 10:130338414-130338436 TGTACCATGGAGGGGCTACAGGG - Intergenic
1079326597 11:19498175-19498197 TCTTCTCTGGAGGAGCCACATGG - Intronic
1081143418 11:39532554-39532576 TCTTCCGTGTAGTGGATACATGG - Intergenic
1085351268 11:75799342-75799364 TCTTCCATCCAGCAGCTCCAAGG - Intronic
1086766268 11:90699222-90699244 TATTACATGTAGAAGCTGCAGGG - Intergenic
1087658406 11:100955411-100955433 TCTACAATGGAGGAGATACAGGG + Intronic
1090659956 11:128874906-128874928 TGTTCCATTTAGGAGCTGGAGGG - Intergenic
1096595751 12:52694162-52694184 TCTGCCATTTACTAGCTACAAGG + Intronic
1097931727 12:65194503-65194525 GCTTCTAGGTAGGGGCTACAAGG + Intronic
1100500642 12:95170761-95170783 TTTTCCATGTTGCAGCTTCATGG - Intronic
1104693684 12:130847234-130847256 TCTTAGAAGTAGGAGCTAAATGG - Intergenic
1109727113 13:66356274-66356296 ACTTCCATGAAGGTGCTGCAGGG - Intronic
1111643118 13:90996078-90996100 TCTGCCATGTTCCAGCTACACGG + Intergenic
1113555557 13:111231323-111231345 TCTACACTGTAAGAGCTACAAGG - Intronic
1115655597 14:35440721-35440743 GCATCCCTGTAGTAGCTACATGG - Intergenic
1117985178 14:61379906-61379928 TCTTTCATGTAGGGGACACACGG + Intronic
1125517049 15:40327213-40327235 TCTACCATGGAGGAGGTAAATGG + Intergenic
1129583481 15:76837433-76837455 TCTTCCATGTGGCAGCAGCAAGG + Intronic
1131623737 15:94096084-94096106 TCTACCATTTACTAGCTACACGG + Intergenic
1133178822 16:4036962-4036984 TCTTATATGTGGGAGCTAAAAGG - Intronic
1135274887 16:21103607-21103629 TTTTCCAGGTAGCAACTACATGG + Intronic
1139092283 16:63662789-63662811 TCTGCAATGGAGGGGCTACATGG - Intergenic
1140140189 16:72248863-72248885 TCTTCCATGTGTGAGATCCATGG + Intergenic
1141290041 16:82709747-82709769 GCTTCCATTTAGTATCTACAGGG + Intronic
1146184676 17:30717171-30717193 TCTCCCATGTAGCAGCTAGAGGG - Intergenic
1153801290 18:8672595-8672617 TCTGCCATATAGGGACTACATGG - Intergenic
1155036203 18:22026906-22026928 TTTTCCTCTTAGGAGCTACAGGG - Intergenic
1155391364 18:25340633-25340655 TCTAGGATGTTGGAGCTACAAGG + Intronic
1156706685 18:39890961-39890983 TCAGACATGTAGGAGCTACATGG + Intergenic
1162974107 19:14198522-14198544 TCTCCCACGTAGCAGCTAGAGGG + Intronic
1163103846 19:15112281-15112303 TCTTGCAGGTAGGTGCCACAGGG + Intronic
1163819131 19:19486257-19486279 GCTTCCATCTGGGAGCTGCAAGG + Intronic
1164278714 19:23749012-23749034 TCTGCAATGCAGGAGCTAGAAGG + Intronic
1168019430 19:53598116-53598138 TCTTCCATGATGTAGATACATGG + Intergenic
1168079518 19:53999237-53999259 TCTTCCATGTAGGAAGTAGTTGG + Intronic
927143374 2:20144709-20144731 TCTTCCATGTAGGGACTAGAGGG + Intergenic
927399257 2:22691924-22691946 TCCTCAATGTAGGAGATACTTGG + Intergenic
929290879 2:40189778-40189800 TCTTCTATGGATGAGCTACTTGG + Intronic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
932439705 2:71726116-71726138 TCTCCCATGTGGCAGCCACATGG - Intergenic
932709723 2:74053615-74053637 TCTTCCCTGAAGAAGCCACAGGG + Intronic
935887361 2:107636640-107636662 TCTTCAATGTAGGAACAACATGG - Intergenic
939289278 2:140172507-140172529 ACTTCCATTTATAAGCTACATGG - Intergenic
939719615 2:145632545-145632567 ACTTTCATCTAGGAGCTCCAAGG + Intergenic
940423802 2:153508814-153508836 TCTCCCAAGTGGGAGCTGCATGG + Intergenic
942187891 2:173441774-173441796 TCTTCAATGTCAGAGCTAAAGGG + Intergenic
942909693 2:181228164-181228186 TATTCCATGTAGAAGCTAGCTGG - Intergenic
946877097 2:224140174-224140196 ACTTCTATGTGGGAGCTAAATGG - Intergenic
1173656490 20:44703422-44703444 TCTTCCATCTCTGAGCTACCCGG - Intergenic
1173921221 20:46746902-46746924 TCTTCCATGCAGCAGCCATAAGG + Intergenic
1177044030 21:16146931-16146953 TCTTACATGCAGGAGGTTCATGG - Intergenic
1177686687 21:24446782-24446804 TTCTCCATTTAGGTGCTACAGGG + Intergenic
1182735942 22:32532421-32532443 TCCTCCAAGTAGGGGCTACTTGG + Intronic
1182929961 22:34163888-34163910 TCTTCCATATAGGAGCTCCTTGG - Intergenic
949760765 3:7467606-7467628 GCCACCATGTAGGAGCTTCAGGG + Intronic
951596078 3:24319629-24319651 TCTTCCAAGTGGTAGTTACATGG + Intronic
951832232 3:26943282-26943304 TCTTCCATTCAGGAGCCACAGGG - Intergenic
953135916 3:40181770-40181792 CCTTTAATTTAGGAGCTACATGG + Intronic
953907843 3:46877210-46877232 TCTTCCGTCTAGGAGCCACTGGG + Intronic
954010214 3:47629981-47630003 TGTTCCAAGCAGAAGCTACAGGG + Intronic
957172557 3:76757418-76757440 TCTTCCATGTTTGAGTTACAGGG + Intronic
957790754 3:84937758-84937780 TATTGCTTGTAGGAACTACAAGG - Intergenic
959508601 3:107183085-107183107 TATTGCATGTAGGTGCTACATGG - Intergenic
966950907 3:184816730-184816752 TTTTCCATGTTGGAACTGCATGG + Intronic
976223474 4:82777090-82777112 TCTGGCATGTAGGAGCTAAAAGG - Intronic
978568384 4:110109872-110109894 TCTTTCATGTCGTATCTACATGG + Intronic
980492832 4:133551908-133551930 TCTTCTATGTCAGAGTTACAAGG + Intergenic
985992708 5:3576572-3576594 TCTTCCATGTTTTAGCTTCAAGG + Intergenic
995271087 5:110220306-110220328 TTTTCCATGAAGAAGCTGCATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996201058 5:120674093-120674115 TCTTACATGTCGACGCTACAGGG + Intronic
997907227 5:137830389-137830411 TCTTCCTTGCAGGTACTACAGGG - Intergenic
998692022 5:144597785-144597807 TCTTCCATGTAGTGAGTACATGG - Intergenic
1000300381 5:159951148-159951170 ACTTGCAGGGAGGAGCTACAAGG - Intronic
1000608052 5:163345135-163345157 TCTTGCCTCTTGGAGCTACAGGG - Intergenic
1001280965 5:170386188-170386210 GATTACATTTAGGAGCTACATGG - Intronic
1002284904 5:178155651-178155673 CCTTCCATGTAAGAGCTGAAGGG - Intergenic
1005963891 6:30712865-30712887 TCTTCCATGGAGTAGGTACAAGG - Exonic
1007841138 6:44716697-44716719 TCTTCCATGGAAGTGCTCCAGGG - Intergenic
1008885919 6:56431521-56431543 TCTTCCATGTAGCATCTGCTTGG + Intergenic
1011145482 6:84210351-84210373 TCTGCCATGTTGGAGTTAAAGGG + Intronic
1016121204 6:140343353-140343375 TCTTCCCAGTGGGAGCTACTAGG + Intergenic
1019145837 6:169975190-169975212 TCTGCCCTTCAGGAGCTACAGGG - Intergenic
1024950450 7:54855478-54855500 TCTCCCATCCAGGAGTTACATGG + Intergenic
1026180452 7:68034743-68034765 ACTTGCATGTAGGAGGTACTTGG + Intergenic
1026211066 7:68305683-68305705 ACTTACAAGTAGGAGCTAAATGG - Intergenic
1026388675 7:69877976-69877998 TCTTCCTAGGAGGAGCCACAAGG + Intronic
1032596022 7:133241372-133241394 CCTTCCAGGTAGGAGAGACAGGG - Intergenic
1036038760 8:5050236-5050258 TCCTTCATGTAGGAGCTGTAAGG - Intergenic
1038848678 8:31253581-31253603 TTTTGCATGTAGGTGCTTCAAGG + Intergenic
1038957414 8:32482657-32482679 TCTTCCATACAGGAGGAACAGGG + Intronic
1040023569 8:42761779-42761801 TTTTCCAAGAAGGAGGTACAGGG - Intronic
1040322852 8:46327262-46327284 TCTTTCATGGAGGATCTCCATGG - Intergenic
1042571917 8:70174994-70175016 TCTCCCATTTAGGGGCAACAGGG - Intronic
1044645833 8:94442165-94442187 TCTCACATGTGGGAGCTAAAAGG + Intronic
1045331267 8:101157701-101157723 CCTTCCATGTGCTAGCTACATGG - Intergenic
1045704637 8:104907607-104907629 TATACAATGTAGGAGCCACATGG + Intronic
1045952756 8:107869997-107870019 TCTTCCATGTGTGAGCCAGATGG - Intergenic
1047121377 8:121908616-121908638 TCTTCCAGTCAGGAGCCACAGGG - Intergenic
1047483546 8:125307624-125307646 TCTTCCAAGAGGAAGCTACAGGG + Intronic
1048428327 8:134343199-134343221 CCTTCAATGTAGGAAGTACAGGG - Intergenic
1053562152 9:39207922-39207944 TCTTCCAAGTTGGAGCAACTGGG + Intronic
1053827958 9:42045923-42045945 TCTTCCAAGTTGGAGCAACTGGG + Intronic
1054134966 9:61411036-61411058 TCTTCCAAGTTGGAGCAACTGGG - Intergenic
1054602600 9:67141523-67141545 TCTTCCAAGTTGGAGCAACTGGG - Intergenic
1056482691 9:87021698-87021720 ACTTCCGTGCACGAGCTACATGG + Intergenic
1059673662 9:116515706-116515728 GCCTGCATGTAGGAGCCACAAGG - Intronic
1061758779 9:132835239-132835261 TCTTCCATGGAGTGGCTTCAGGG - Intronic
1061981689 9:134108409-134108431 CCTCCTATGTGGGAGCTACAAGG + Intergenic
1188381408 X:29497448-29497470 TCTTCCATGTAGGAGCTACATGG + Intronic
1189700931 X:43715942-43715964 TCTTCCAGGAATGAGCCACACGG + Intronic
1189701831 X:43720396-43720418 TCTTCCAGGAATGAGCCACATGG + Intronic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192598620 X:72438029-72438051 TCTTCCATTCAGGAGGCACAGGG - Intronic
1195288822 X:103411807-103411829 ACTTATATGTAGGAGCTAAATGG - Intergenic
1195399595 X:104447373-104447395 TCTTCCATCTAAGATCTGCAGGG + Intergenic
1197201613 X:123753617-123753639 TCTTCCATCTAGCTGCTCCATGG + Intergenic
1197620547 X:128742955-128742977 TCTTCCCTGTAGGAGATAAGAGG - Intergenic
1200697435 Y:6373457-6373479 TCTTCCATGGAGGTGCATCAGGG - Intergenic
1200715000 Y:6528754-6528776 TATTCCATGTTGGAACCACAAGG + Intergenic
1201036678 Y:9791242-9791264 TCTTCCATGGAGGTGCATCAGGG + Intergenic