ID: 1188387086

View in Genome Browser
Species Human (GRCh38)
Location X:29574743-29574765
Sequence GCAAAGGGATGATCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 22, 2: 56, 3: 158, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188387086_1188387089 6 Left 1188387086 X:29574743-29574765 CCAGTTTCAGATCATCCCTTTGC 0: 1
1: 22
2: 56
3: 158
4: 438
Right 1188387089 X:29574772-29574794 ATATGCTGTTAGAAGCAGCCAGG 0: 26
1: 77
2: 279
3: 347
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188387086 Original CRISPR GCAAAGGGATGATCTGAAAC TGG (reversed) Intronic
900123787 1:1060567-1060589 GCAAACGGAGGTGCTGAAACCGG + Intergenic
900628348 1:3620197-3620219 ACAAGGAGATGATCTGAAATTGG + Intergenic
900738391 1:4314726-4314748 GCAAAGAGATGATCTGACACTGG - Intergenic
901786032 1:11625604-11625626 GCAAAGTGATCAGATGAAACGGG - Intergenic
902085266 1:13855491-13855513 ACAAAGAGATTATCTGAAACTGG + Intergenic
902540660 1:17152182-17152204 GCAAATAAATGACCTGAAACTGG + Intergenic
904624394 1:31793907-31793929 GCAGAGGCAGGAGCTGAAACAGG + Intronic
905067461 1:35195444-35195466 GAAAAGGGATGATCAGTAAGAGG - Intergenic
905300066 1:36980903-36980925 GCAAAGGGATGGACAGATACTGG - Intronic
905437592 1:37968151-37968173 GCAAAAGGATCATGTGAAATGGG + Intronic
905834785 1:41108337-41108359 GCTAAGGTATAATCTGAAACTGG + Intronic
905922581 1:41729209-41729231 GCACAGGGGTGATCAGTAACCGG + Intronic
906083527 1:43109686-43109708 GCAAAGAGATGATCTAAAACTGG - Intergenic
906546338 1:46621886-46621908 GCAAGGGGAAGGTCTGCAACTGG - Intergenic
907372801 1:54014044-54014066 GCAAATGGAGGCTCAGAAACAGG + Intronic
907920303 1:58905220-58905242 GTAAAGCCAAGATCTGAAACTGG - Intergenic
908487732 1:64611404-64611426 ACAAAGAGATTATCTAAAACTGG - Intronic
908620577 1:65975371-65975393 GCAAAGAGATTATCTGAAACTGG + Intronic
908878974 1:68709701-68709723 GCAAAGAGATGGTCTGAAATTGG + Intergenic
909133385 1:71767516-71767538 GCAAAGAAATGACCTGGAACTGG + Intronic
909369049 1:74862474-74862496 GCAAAGAGATTATCTTAAGCTGG - Intergenic
910128591 1:83874731-83874753 GCAAAGGTAGAATTTGAAACTGG - Intronic
910563618 1:88619023-88619045 ACAAAGAGATGGTCTGAAATTGG - Intergenic
911009427 1:93263367-93263389 ACAAAGAGATGATCTGAAATTGG - Intronic
911023064 1:93408148-93408170 ACAAAGAGATGGTCTGAAATTGG + Intergenic
911117926 1:94265467-94265489 GAAAAAGGATGGTCTGAGACTGG - Intronic
911235065 1:95403753-95403775 GCAAAGAGATGGTCTGAAATTGG + Intergenic
911302481 1:96192384-96192406 GCAAAGAAATGACCTGAGACTGG + Intergenic
911708393 1:101041073-101041095 ACAAAGAAATGACCTGAAACTGG - Intergenic
911790236 1:102005752-102005774 GGAAAGAGATGATCAGAAGCTGG - Intergenic
911817120 1:102367896-102367918 ACAAAGAGATGATTTGAAATTGG + Intergenic
912059894 1:105654497-105654519 GTAAAGGGAAGATTAGAAACTGG + Intergenic
912070367 1:105801477-105801499 ACAAAGAGATGGTCTGAAATTGG - Intergenic
912136118 1:106662194-106662216 GCAGAGAGGTGATCTGAAATTGG + Intergenic
913396123 1:118374812-118374834 ACAAAGAGATTTTCTGAAACTGG + Intergenic
914827219 1:151145177-151145199 GCAACGGGAGGATCTGGAAAGGG - Intronic
914851362 1:151316574-151316596 GCAAAGGGAAGATCTGAGGATGG - Intronic
914905041 1:151737148-151737170 GCAAAGAAATGATGTAAAACTGG + Intergenic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
915885606 1:159717948-159717970 ACAAAGAGATGATCTGAAATTGG + Intergenic
916384779 1:164255257-164255279 GCAAAGAGATAGTCTGAAATTGG + Intergenic
916649375 1:166820490-166820512 GCAAAGAAATGATCTGAAACTGG - Intergenic
916829181 1:168473983-168474005 ACAAAGAGATGATCTGAAGTTGG + Intergenic
917051786 1:170932533-170932555 GCAAAGAGATGGTCCGAAACTGG - Intergenic
917696871 1:177534217-177534239 GCAAATAGATGATCTGCAACTGG - Intergenic
918323129 1:183383528-183383550 GCAAAGAGGTTATCTGAAACTGG - Intronic
918437384 1:184529905-184529927 GCAAAGCCATGATCTGAACCAGG - Intronic
918485926 1:185027953-185027975 GCAAAGAGATGATCTGAAACTGG - Intergenic
918956789 1:191218101-191218123 ACAAAGAGATGGTCTGAAATTGG - Intergenic
919007014 1:191910665-191910687 TGAAAGAGATGATCTGAAATTGG - Intergenic
920395063 1:205639133-205639155 GAAAGGGGATCAACTGAAACTGG - Intergenic
920562901 1:206951848-206951870 CCAAAAGGAAGAACTGAAACAGG - Intergenic
920699836 1:208209464-208209486 GAAAAGGGATTAGCTGAGACCGG + Intronic
920778639 1:208966235-208966257 CCAAAGGGAATATATGAAACAGG + Intergenic
920793754 1:209118056-209118078 GCCAAGAGAGGATCTGAGACTGG - Intergenic
921621501 1:217330603-217330625 GCAAAGAGATGATGTGAAACTGG - Intergenic
923941460 1:238832107-238832129 ACAAAGAGATTATCTGAAACAGG + Intergenic
924476326 1:244384781-244384803 GCAAAGGGCTGGTCTGCAAGAGG + Intronic
924759305 1:246969167-246969189 GGAAAGAGATTATCTGAAACTGG - Intronic
924936536 1:248776917-248776939 ACAAAGAAATGATCTGAAATTGG + Intergenic
1063310163 10:4944842-4944864 CCAAAGAGATTATCTGACACTGG + Intronic
1063317137 10:5017308-5017330 CCAAAGAGATTATCTGAAACTGG - Intronic
1063428481 10:5967501-5967523 GCAAAGGAATGATCTGATCTTGG - Intronic
1068163092 10:53293331-53293353 GCAAAGAGATGTACTGAAACTGG + Intergenic
1068374734 10:56164335-56164357 ACAAAGAGATGATCTGAAAGTGG + Intergenic
1068449407 10:57166082-57166104 ACAAAGAAATTATCTGAAACTGG - Intergenic
1068580238 10:58731034-58731056 GCAAAGATGTTATCTGAAACTGG - Intronic
1070224232 10:74483611-74483633 GCAAAGAGATGATCTGAAACTGG - Intronic
1071042962 10:81336710-81336732 GCAAAGAGATGATCTGACAATGG + Intergenic
1071457479 10:85861944-85861966 GGAAAGGGAGGATCTGAGGCTGG - Intronic
1071889486 10:89987538-89987560 GGAAGGGGATGATCTAAAAGGGG - Intergenic
1071962687 10:90822490-90822512 GCAAAGAGATGATCTGAAACTGG + Intronic
1072358122 10:94632481-94632503 CCAAAGAGATTATCTGAAACTGG + Intergenic
1073006764 10:100330563-100330585 GCAATGGGAGGAGCTGAGACAGG + Intergenic
1074657897 10:115616331-115616353 GCAAAGAAATGACTTGAAACTGG + Intronic
1074790583 10:116882749-116882771 TCAAAGCTATGATTTGAAACTGG + Intronic
1075396006 10:122127505-122127527 GCAAAGGGTTGATTTGCCACTGG - Intronic
1076155452 10:128201756-128201778 GCAAAAAGATGATCTGAAATTGG + Intergenic
1076317489 10:129552569-129552591 CCAAAGCGATGAACTGACACCGG - Intronic
1077557525 11:3232823-3232845 GGAAAGGCACGGTCTGAAACGGG - Intergenic
1078747527 11:14129248-14129270 ACAAAGAGATGGTCTGAAATTGG - Intronic
1078978538 11:16505441-16505463 GCAAAGACATAATCTGAAACTGG + Intronic
1079713617 11:23717682-23717704 ACAAAGAGATTATCTGAAACTGG + Intergenic
1079819412 11:25106114-25106136 GCAAAGATATGCTCTGAAACTGG - Intergenic
1079980907 11:27150504-27150526 GCAAAGATATGGTCTGAAACTGG - Intergenic
1080843404 11:36005221-36005243 ACAAAGAGATTATCTGAAATTGG - Intronic
1080946380 11:36979481-36979503 GGAAAGAAATAATCTGAAACTGG - Intergenic
1081016823 11:37892264-37892286 GCAAAGAGATGTTCAGAAATTGG - Intergenic
1081109711 11:39120207-39120229 GCAAAGAGATGATCTGAAACCGG - Intergenic
1081261812 11:40970996-40971018 GCAAAGAAATGACCTGAAACTGG + Intronic
1082142959 11:48631058-48631080 GCAAAGAAATGACATGAAACTGG - Intergenic
1082270624 11:50166249-50166271 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1082616912 11:55371877-55371899 GCACAGAAATGACCTGAAACTGG - Intergenic
1082619404 11:55401365-55401387 GCAAAGAAATGATCTGAAAATGG - Intergenic
1082632705 11:55560354-55560376 ACAAAGGGAGGATGTGAAAGAGG - Intergenic
1082711696 11:56560742-56560764 TCAAAGAGATGGTCTGAAATTGG + Intergenic
1083136180 11:60678664-60678686 GCAAAGAGATTATCTGAAACTGG - Intergenic
1084200138 11:67551478-67551500 ACAAAGAGATGATTTGAAATTGG + Intergenic
1085818773 11:79770296-79770318 ACAAAGAGATGATCTGAAACTGG + Intergenic
1085847590 11:80083653-80083675 GCACAGGGTTGAACTGACACTGG + Intergenic
1085976416 11:81660636-81660658 GCAAAGAGATGATCTGAAACTGG - Intergenic
1086432599 11:86749651-86749673 GCAGGGGGAAGAGCTGAAACAGG + Intergenic
1086799453 11:91153126-91153148 GCAAAGAAATGATCTGAAAATGG - Intergenic
1086821646 11:91442979-91443001 ACAAAGTGATGATCTGAAATTGG - Intergenic
1087389705 11:97517267-97517289 GCACATAGATAATCTGAAACAGG - Intergenic
1087433275 11:98080675-98080697 GCAAAGAAATGACCTGAAACTGG + Intergenic
1087603702 11:100347963-100347985 TCAAAGGCATGATCTGAAAATGG - Intronic
1087708339 11:101520940-101520962 GCAAAGGAATGATCTGAAACTGG + Intronic
1088188996 11:107206046-107206068 ACAAAGAAATGACCTGAAACTGG - Intergenic
1088785055 11:113173930-113173952 GCTAAGGGATGATTTGGAACAGG - Intronic
1090595413 11:128315497-128315519 ACAAAGAGATGATCTGAAACTGG - Intergenic
1091316397 11:134617049-134617071 GCAAAGGGATGACCTAAAGTTGG + Intergenic
1091552785 12:1549556-1549578 GCAAAGACATTATCTGAAACTGG + Intronic
1091674201 12:2476723-2476745 GCAAAGGGATGGTGGGTAACTGG - Intronic
1092965108 12:13633855-13633877 GCCAAGGGAGAATCAGAAACAGG - Intronic
1093093486 12:14946699-14946721 GCAAAGGAAAGCTCTGGAACAGG - Intronic
1093334076 12:17879144-17879166 GCTAAGAGATGATCTGAAACTGG - Intergenic
1093478694 12:19583018-19583040 ACAAAGAGATGGTCTGAAATTGG + Intronic
1093591355 12:20905457-20905479 ACAAAGAGATTATCTGAAACTGG - Intronic
1093596776 12:20972121-20972143 ACAAGTAGATGATCTGAAACTGG + Intergenic
1094471433 12:30804945-30804967 GCAAAGAAAAGATCTGAAACTGG - Intergenic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1095226787 12:39686791-39686813 GCAAAGAAATGATATAAAACTGG - Intronic
1095639177 12:44467530-44467552 GCAAAGAAATGATCTGAAATTGG + Intergenic
1095974122 12:47927654-47927676 AAAAAGGAATGATCTGAAAGAGG + Intronic
1096498586 12:52052439-52052461 GCATAGGGATGATCAGCATCTGG - Intronic
1096867741 12:54575292-54575314 GCAAAAGGAGGATGTGGAACAGG - Intronic
1096886951 12:54727536-54727558 ACAAAGAGATAATCTGAAATTGG - Intergenic
1097139223 12:56885988-56886010 GCAAAGAGATGATCTGAAACTGG + Intergenic
1097501605 12:60410432-60410454 ACAAAGAAATGAGCTGAAACTGG - Intergenic
1097623637 12:61972767-61972789 GCAATGGGATGATCTGCTAAGGG + Intronic
1098559168 12:71852551-71852573 GCAAAGAAATGACCTGAAACTGG - Intronic
1098702997 12:73652801-73652823 GCAAAGAGATTATCTGAAACAGG + Intergenic
1099487704 12:83249002-83249024 GCAAAGAGATGATCTGAAACTGG + Intergenic
1099558888 12:84148272-84148294 GCAAAGAGATTATTTGAAACTGG + Intergenic
1099587079 12:84532686-84532708 GCAAATAGATGACTTGAAACTGG + Intergenic
1099984602 12:89648537-89648559 GCAAAGGAATGACCTGAAGTTGG + Intronic
1100123352 12:91394763-91394785 GGAGAGAGATGATCTGAAATTGG + Intergenic
1101259895 12:103018400-103018422 GCAAAGAAATGATCTGAAAGTGG - Intergenic
1103223523 12:119266951-119266973 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1104115873 12:125748608-125748630 ACAAAGGGATGGTTTGAAATTGG + Intergenic
1104476922 12:129078381-129078403 GCAAAGGGCTCTTCTGAAGCAGG - Intronic
1106960391 13:34990807-34990829 GCAAAGAGATGATCTGAAACTGG - Intronic
1108300969 13:49075825-49075847 GCACAGGTAGGATCTGAAAGGGG - Intronic
1108512529 13:51169347-51169369 GCAAACAGATGATCTGAAACTGG + Intergenic
1108768322 13:53663084-53663106 ACAAAGATATGATATGAAACTGG + Intergenic
1109130241 13:58575321-58575343 GCAAAGAGATAGTCTGAAATTGG - Intergenic
1109485307 13:63010554-63010576 GCAAAGAGATTATCTGAAACAGG - Intergenic
1109503658 13:63270616-63270638 GCAAAGGAATGACTTAAAACTGG - Intergenic
1109857896 13:68156852-68156874 GCAAATAAATGACCTGAAACTGG - Intergenic
1110440492 13:75520761-75520783 GCAAAGAAATGATATGAAACTGG + Intergenic
1110531912 13:76607685-76607707 GCAAAGGGAGGATGATAAACAGG - Intergenic
1110868645 13:80424502-80424524 GCAAAGAAATGACCTGAAACTGG - Intergenic
1110902308 13:80838066-80838088 CCAAGAGGATGGTCTGAAACTGG - Intergenic
1111008567 13:82282024-82282046 GCAAAGAAATGACCTGAAACTGG - Intergenic
1111221266 13:85208108-85208130 ACAAAGAGATTATCTGAAACTGG + Intergenic
1112790362 13:102995849-102995871 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1113203149 13:107888615-107888637 GCAAAGAAATGACCTGAAACTGG - Intergenic
1113284159 13:108828370-108828392 GCAGAGCCAGGATCTGAAACTGG - Intronic
1113320715 13:109229452-109229474 ACAAAGAGATGATCTAAAACTGG - Intergenic
1113496916 13:110738329-110738351 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1113501943 13:110782632-110782654 ACAAAGAGATGATCTGAAATTGG - Intergenic
1114347939 14:21816786-21816808 GCAAAGAAAGGATCTGAAATTGG - Intergenic
1115289323 14:31752295-31752317 ACAAAGAGATGATCTGAAATTGG - Intronic
1115944351 14:38643337-38643359 ACAAAGAGATGATCTGAAATTGG + Intergenic
1116263412 14:42659791-42659813 ACAAAGAGATAACCTGAAACTGG + Intergenic
1116427767 14:44811042-44811064 GGAAAGTGATGATCTGAAAGGGG - Intergenic
1116713250 14:48396665-48396687 GCAAAGAGATGAACTAAAACTGG + Intergenic
1116998182 14:51346240-51346262 ACAAAGAGATTATCTGAAACTGG + Intergenic
1117241443 14:53837770-53837792 ACAAAGAGAGGATCTGAAACTGG - Intergenic
1117566122 14:56995320-56995342 GCAAACGGATCATGTGAGACTGG - Intergenic
1119969514 14:78953834-78953856 GGAAAGTTATGATCTGCAACTGG - Intronic
1120050091 14:79856091-79856113 GCAAAGGGTTTGTCTGAAATAGG - Intronic
1120101486 14:80450308-80450330 ACAAAGAGATGATCTGAAACTGG + Intergenic
1120225788 14:81789923-81789945 ACAAAGAGATGATCTGAAATTGG + Intergenic
1120230479 14:81836103-81836125 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1120257658 14:82140827-82140849 ACAAAGAAATGACCTGAAACTGG + Intergenic
1120583171 14:86279391-86279413 GCAAAGACATGACCTGAAACTGG + Intergenic
1120693849 14:87622060-87622082 ACAAAGAGATTATATGAAACTGG - Intergenic
1121238012 14:92406994-92407016 ACAAAGAGATTATCTGAAATTGG - Intronic
1122004385 14:98690009-98690031 GCAAAGGCAATTTCTGAAACAGG - Intergenic
1124444899 15:29722014-29722036 ACAAACAGATTATCTGAAACTGG + Intronic
1124509142 15:30307296-30307318 ACAAAGAGATTATTTGAAACTGG - Intergenic
1124734417 15:32231366-32231388 ACAAAGAGATTATTTGAAACTGG + Intergenic
1125680841 15:41529356-41529378 GCAAAGGCATGAACTAGAACAGG + Intronic
1125730872 15:41892273-41892295 GCAAAGGGATCATTGGAAACCGG - Intronic
1126488585 15:49211085-49211107 GCAAAGAAATGACCTGAAACTGG - Intronic
1127026623 15:54814390-54814412 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1127137809 15:55943147-55943169 TCACAGAAATGATCTGAAACTGG + Intronic
1129117874 15:73375291-73375313 GAAAAGGGATCATGTGAAATTGG - Intergenic
1132260976 15:100424716-100424738 ACCAAGAGATGTTCTGAAACTGG + Intronic
1133386179 16:5372067-5372089 GCAAAGGAAATATCTGAAGCCGG - Intergenic
1135119571 16:19754003-19754025 CCAAAGGGATGCACTGAATCAGG - Intronic
1135433706 16:22409995-22410017 GCAAAAGCAGGATCTGAAAAAGG - Intronic
1135882587 16:26273094-26273116 GGGAAGGGATGATATGATACTGG + Intergenic
1136330618 16:29573821-29573843 GCAAAGGAATCATTTGAACCCGG + Intergenic
1137495678 16:48967316-48967338 GCAAAGGGAAGAGCAGAATCAGG + Intergenic
1138615420 16:58161686-58161708 GAAAAGAGATGGTCTGAAACTGG + Intronic
1138800176 16:60017146-60017168 ACAAAGGGATGATTTGAAATTGG - Intergenic
1138923326 16:61559692-61559714 GAAAAGAGATGTTCTGAAAGAGG + Intergenic
1141272843 16:82556554-82556576 GCAAAGACATGACCTGAAACTGG - Intergenic
1141306163 16:82865885-82865907 ACAAAGAGAAGATTTGAAACTGG - Intronic
1142281273 16:89149056-89149078 GCAAAGAGATGACCTGAAACCGG - Intronic
1142924546 17:3223418-3223440 ACAAAGAGATTATCTGAAATTGG + Intergenic
1143305565 17:5943904-5943926 GCAAAGGCAGAATTTGAAACTGG - Intronic
1144368882 17:14571004-14571026 GCAAAGAAATGACCTGAAATTGG - Intergenic
1144790305 17:17854616-17854638 GCACAAGGATTATCTGAACCTGG - Intronic
1145022503 17:19442825-19442847 GCAAATAAATGAGCTGAAACTGG + Intergenic
1146391719 17:32429295-32429317 GCAAAGAGATTATCTGAAACTGG + Intergenic
1147244883 17:39113440-39113462 GCAAGGGGATGATGTGGAACAGG - Intronic
1148259800 17:46171548-46171570 GAAATGGGAGGATCTGAATCTGG - Exonic
1149178295 17:53901872-53901894 ATAAAGAAATGATCTGAAACTGG + Intergenic
1150316566 17:64174284-64174306 GCAAAGGAAGGACCTGAGACAGG + Intronic
1150350286 17:64438951-64438973 ACAAAGGGATAATCTGAAATTGG - Intergenic
1152072887 17:78142776-78142798 CCAAAGGGATGCTCTGATTCAGG - Exonic
1153556831 18:6323696-6323718 GCAAAGATATGACCTGAAATTGG + Intronic
1155707910 18:28838738-28838760 GCCAAGAGATGATCTGAAACTGG - Intergenic
1156151662 18:34250437-34250459 ACAAAGAGATGATCTGAAACTGG - Intergenic
1156632311 18:38984899-38984921 ACAAAGAGATTGTCTGAAACTGG + Intergenic
1156683477 18:39618090-39618112 GCAAAGAGATTATCTGAAACTGG - Intergenic
1156914438 18:42448397-42448419 GCAAAGAGATTATCTAAAACTGG - Intergenic
1157077188 18:44479044-44479066 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1158092252 18:53727891-53727913 GTAACGAGATGATCTGAAACTGG - Intergenic
1158129667 18:54139135-54139157 ACAAAGAGATTATCTGGAACTGG + Intergenic
1159071180 18:63625344-63625366 ACAAAGAGATTATCTGAAACTGG - Intergenic
1159803113 18:72924439-72924461 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1160051466 18:75438051-75438073 GGAATGGCATGATCTGACACAGG + Intergenic
1160153348 18:76412320-76412342 CCAAAGGGACGGCCTGAAACAGG + Intronic
1162769788 19:12942267-12942289 GCAAAAGGATGACGTGAACCCGG + Intronic
1164537218 19:29094825-29094847 GAACAGGGCTGATCTCAAACTGG + Intergenic
1165969364 19:39613557-39613579 AAAAAGAGATGATCTGAAACTGG + Intergenic
1166624079 19:44334324-44334346 GCAAAGAGATTATCTGAAACTGG + Intronic
1167134093 19:47607035-47607057 GCAAAGGCAGGATATGAACCAGG + Intergenic
925061701 2:896628-896650 GCAAAGAAATGACCTGAAACTGG + Intergenic
925393051 2:3512052-3512074 GCAAAGGAATGACCTGAAGTTGG + Intronic
926067938 2:9859107-9859129 ACAAAGAGATTATCTGAAACTGG - Intronic
926461521 2:13135705-13135727 GCAAAGGAATGATCTAAAGGTGG + Intergenic
926598188 2:14813608-14813630 ACAAAAAGATTATCTGAAACTGG + Intergenic
927033847 2:19151188-19151210 GCAAATAAATGACCTGAAACTGG - Intergenic
927329053 2:21841313-21841335 ACGAAGAGATAATCTGAAACTGG + Intergenic
928042826 2:27895675-27895697 ACAAAAGGATGATGAGAAACCGG - Intronic
929362066 2:41103751-41103773 GCAAGAGGATCATCTGAACCCGG + Intergenic
929612709 2:43283750-43283772 ACAAAGAGATTATCTGAAACTGG + Intronic
930659643 2:54040960-54040982 GGAAAGGGATGAGCTGATGCAGG + Intronic
930686370 2:54312777-54312799 GCAAAAGCATGATGGGAAACAGG - Intergenic
931154045 2:59607782-59607804 AGAAAGAGATGGTCTGAAACTGG + Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
931529589 2:63199161-63199183 GAGTAGAGATGATCTGAAACTGG + Intronic
932654479 2:73597730-73597752 ATAAAGGGAAGACCTGAAACTGG + Intronic
933070825 2:77856651-77856673 GCAAATAAATGACCTGAAACAGG + Intergenic
933521501 2:83380591-83380613 GCAAAGAGATGATTTGAAACTGG + Intergenic
933539437 2:83619587-83619609 ACAAAGAGATAGTCTGAAACTGG - Intergenic
933985747 2:87590972-87590994 ACAAAGAAATGATCTGAAATTGG + Intergenic
934119075 2:88823058-88823080 CCAAAAGGCTGAACTGAAACTGG + Intergenic
935324525 2:101924464-101924486 GCAAAGAAATGATCTGAAACTGG + Intergenic
935798665 2:106670786-106670808 GCAAAGACATGATCTGAAATGGG + Intergenic
936308095 2:111359832-111359854 ACAAAGAAATGATCTGAAATTGG - Intergenic
937493118 2:122390100-122390122 ACAAAGAGATGATCTGAAATGGG - Intergenic
937995497 2:127691140-127691162 GCAAAGAAATGACCTGAACCTGG - Intergenic
938064872 2:128276446-128276468 AAAAAGTGATGAGCTGAAACAGG + Intronic
938622581 2:133071878-133071900 GCAGAGGTGGGATCTGAAACAGG - Intronic
939247653 2:139645935-139645957 CCAAATGGATGAGCTGAAACTGG - Intergenic
939361195 2:141175138-141175160 ACAATGAGATGATCTGAAAATGG + Intronic
939754677 2:146094702-146094724 GCAAAGAGATTATCTGAAACTGG - Intergenic
940499597 2:154477667-154477689 ACAAAGAGATTATGTGAAACTGG + Intergenic
940597903 2:155818639-155818661 ACAAAGAGATGATATGAAATTGG + Intergenic
940826316 2:158416379-158416401 GAGCAGAGATGATCTGAAACTGG - Intronic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
942203322 2:173593546-173593568 ACAAAGAGATTATCTGAAACTGG - Intergenic
943124708 2:183782303-183782325 ACAAAGAGATGATTTGAAATTGG + Intergenic
943248325 2:185484586-185484608 ACAGAGAGATGATCTGAAATTGG + Intergenic
943303213 2:186229482-186229504 GCAAAGAAATGACCTGAAACTGG + Intergenic
943609538 2:190015727-190015749 ACAAAGAGATGGTTTGAAACTGG - Intronic
944491452 2:200262417-200262439 GCAAAGAAATGATGTGAAATTGG + Intergenic
945084545 2:206117968-206117990 GCAAATATATGATCTGAGACTGG - Intronic
945172820 2:207014388-207014410 GAATTGGCATGATCTGAAACAGG - Intergenic
945356224 2:208843009-208843031 GCAAAGAGATGATCTGAAACTGG + Intronic
945533993 2:210989365-210989387 GCAAAGAAATGTCCTGAAACTGG + Intergenic
946317217 2:218924291-218924313 ACAAAGAGATGATCTGAAACTGG - Intergenic
946753599 2:222919586-222919608 GGAAAGGGAAGAACTGGAACAGG - Intronic
946804974 2:223462947-223462969 ACAAAGAAATGACCTGAAACTGG + Intergenic
946937314 2:224735794-224735816 ACAAAGAGATTATCTGAAACTGG + Intergenic
946963412 2:225009723-225009745 CCAAAGCAATGAACTGAAACTGG + Intronic
946990037 2:225318377-225318399 GCAAAGAGATGATCTAAAACTGG + Intergenic
947029817 2:225781534-225781556 ACAAACTGATGATCAGAAACAGG - Intergenic
947488502 2:230574037-230574059 GCAAAAAGATGATCTGAAATGGG - Intergenic
947904450 2:233750326-233750348 TCAGAGAGATGATCTGAAATTGG + Intronic
948104168 2:235399843-235399865 GCAAAGAGATGATCTGAAACTGG + Intergenic
1168931021 20:1623994-1624016 GCACAGAGATGACTTGAAACTGG - Intergenic
1169160751 20:3376101-3376123 GGAAAGTGTTGATCTGAAATAGG - Intronic
1171418594 20:25000897-25000919 GCAGAAGGATCATCTGAACCTGG - Intergenic
1172367637 20:34362333-34362355 GAAAAGGGAGGATTTGAATCCGG + Intergenic
1173098367 20:40060298-40060320 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1175203625 20:57294300-57294322 TCATATGGATGATCTGTAACAGG - Intergenic
1175809825 20:61852037-61852059 GAAAAGGGAAGAGCTGAATCTGG - Intronic
1175928725 20:62483391-62483413 TCAAAGAGATAATCTGAAAAGGG + Intergenic
1177169649 21:17641009-17641031 GCAAAGAAATGACCTGAAATCGG - Intergenic
1177186961 21:17807888-17807910 ACAAAGAGATGATCTGAAACTGG + Intronic
1177312233 21:19412746-19412768 GCAAAGAGATAATCTGAAACTGG + Intergenic
1177517609 21:22176036-22176058 GCAAAGAGATGATCTGAAACTGG + Intergenic
1177594174 21:23213667-23213689 ATAAAGAGATTATCTGAAACTGG - Intergenic
1177602612 21:23335691-23335713 GCAAAGAGAGTTTCTGAAACTGG + Intergenic
1177662110 21:24098239-24098261 ACAAAGAGATGATGTGAAATTGG + Intergenic
1177722611 21:24927686-24927708 GCAAAAAAATGACCTGAAACTGG + Intergenic
1178207417 21:30486115-30486137 ACAAAGAGATTATCTGAAGCTGG + Intronic
1181308758 22:21932270-21932292 GAAAAGGGATTCTCTGAAGCAGG - Intronic
1181448713 22:23001209-23001231 GTAAAGAGATGATCTGAAACTGG - Intergenic
1181478621 22:23183455-23183477 GCAAATGGAAGATCAGTAACTGG - Intronic
1181825756 22:25514266-25514288 GCACAGAGATGTTCAGAAACTGG - Intergenic
1182023158 22:27098049-27098071 GCAGAGGCAGGATCTGAACCCGG + Intergenic
1183270309 22:36858181-36858203 GCAGAGGGATGACCTGGAAGAGG - Intergenic
949230498 3:1744520-1744542 ACAAAGAGATGATCTGACATTGG - Intergenic
950891040 3:16404709-16404731 GCAAAGTGAGGAACTGAGACTGG - Intronic
950972390 3:17202348-17202370 GCAAAGAGATGATCTGAAACTGG + Intronic
951449437 3:22819659-22819681 GCAAAAAAATGACCTGAAACTGG - Intergenic
952221469 3:31327798-31327820 GCAAAGAAATGACCTGAAACTGG - Intergenic
952735113 3:36681405-36681427 ACAAAGAAATGACCTGAAACTGG - Intergenic
953841073 3:46390629-46390651 ACAAGGGGAGGATGTGAAACAGG + Intergenic
953926424 3:46984945-46984967 GCAAAGGGATGGTTTTAAAGAGG + Intronic
956252892 3:67253329-67253351 ACAAAGAGATGATCTGAAATTGG + Intergenic
957293355 3:78306161-78306183 GCAAAGGGGTGATCTGAAACTGG + Intergenic
957403064 3:79742035-79742057 ATAAAGAGATGATCTGAAACTGG + Intronic
957506774 3:81131542-81131564 GCAAAGAGATTATCTGAAGCTGG + Intergenic
957746357 3:84347982-84348004 GCAAAGAAATGACCTGAAATTGG - Intergenic
958175506 3:89991161-89991183 GCAAAGAGAGTATCTAAAACTGG + Intergenic
958256512 3:91331723-91331745 GCAAAGAAATGATCTGAAACTGG + Intergenic
958474848 3:94568365-94568387 ACAAAGAGATTATCTGAAACTGG + Intergenic
958650127 3:96927497-96927519 GGAGAGAGATTATCTGAAACTGG - Intronic
958710153 3:97708446-97708468 ACAAAGAGATGGTCTGAAATTGG + Intronic
958754456 3:98234290-98234312 ACAAAGAGATTTTCTGAAACTGG + Intergenic
958836807 3:99156229-99156251 ACAAAGAGATGGTCTGAAATGGG + Intergenic
959125223 3:102282969-102282991 ACAAAGAGGTTATCTGAAACTGG + Intronic
959149400 3:102590817-102590839 GCAAAGAAATAATCTGCAACTGG + Intergenic
959245461 3:103862409-103862431 GCAAAGAAATGATGTAAAACTGG + Intergenic
960363573 3:116743946-116743968 GCTATTGGAGGATCTGAAACAGG + Intronic
960988764 3:123297093-123297115 CCTATGGGATGATCTGAAGCCGG + Intronic
961029777 3:123591409-123591431 ACAAGGAGATGATCTGAAATTGG - Intergenic
963343202 3:144062529-144062551 TCAAAGGGATCATTTTAAACAGG + Intergenic
963422975 3:145086155-145086177 ACAAAGGAAAGATCTAAAACAGG - Intergenic
963510078 3:146236005-146236027 GCAAAGAAATGACCTAAAACTGG + Intronic
963777389 3:149452727-149452749 GCAAAGAAATGATGTAAAACTGG - Intergenic
964092746 3:152895377-152895399 GCAAAAGAATCACCTGAAACCGG + Intergenic
964154072 3:153563886-153563908 GCAAAGAGATGATTTGAAACTGG + Intergenic
964629330 3:158792902-158792924 GCAAAGGGATGATTTCATACTGG - Intronic
965290454 3:166872479-166872501 GCAAAGAAATGATCTGAAACTGG + Intergenic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965394966 3:168152350-168152372 ACAAAGAGATCATCTGAAACTGG + Intergenic
965397346 3:168174954-168174976 GCAAAGAAATAATCTGAAACTGG - Intergenic
965647234 3:170897150-170897172 ATGAAGAGATGATCTGAAACTGG + Intronic
966302623 3:178496359-178496381 ACAAAGAGATTATCTGAAACTGG + Intronic
966333467 3:178841002-178841024 ACAAAGAGATGATTTGAAATTGG - Intronic
967519926 3:190417170-190417192 TCAAAGAGATTATCTGAAATTGG - Intergenic
968530439 4:1088446-1088468 ACAAAGAGATGATCTAAAATTGG + Intronic
969107909 4:4821931-4821953 GCAAAGAGATCATCTGAAACTGG + Intergenic
969198366 4:5581628-5581650 GCAAAGAAATGACCTGAAACTGG + Intronic
970150346 4:13082554-13082576 ACAAAGAGATTATCTGAAACTGG - Intergenic
971545524 4:27880496-27880518 GCAAAGAAATGAACTGAAACTGG - Intergenic
971593543 4:28498447-28498469 ACAAAGAGATGATCTGAAATTGG - Intergenic
972096293 4:35350782-35350804 GCAAAGAGATGGTCTGAAATTGG - Intergenic
972359459 4:38314111-38314133 GCAAAGGAAATGTCTGAAACTGG - Intergenic
972367726 4:38392162-38392184 GCAAAGAAATGACCTGAAATTGG + Intergenic
972538483 4:40018900-40018922 GCAAAGGGATCATTTGCAAAAGG - Intergenic
972881903 4:43434882-43434904 GCAAAGGTAATATCTGAAAAGGG + Intergenic
972896005 4:43620654-43620676 ACAAAGAGATGGTCTGAAATTGG - Intergenic
973074414 4:45904545-45904567 ACAAAGAGATGGTCTGAAATTGG - Intergenic
973571604 4:52245568-52245590 GAAAAGGTAAGATTTGAAACTGG - Intergenic
973625162 4:52764457-52764479 GGAAGGGGATGATCAGACACTGG - Intergenic
974267370 4:59602911-59602933 ACAAAGAGATGATATGAAATTGG + Intergenic
974311045 4:60210099-60210121 ACAAAGAGATTATCTGAACCTGG - Intergenic
974556783 4:63461014-63461036 ACAAAGAGATAATCAGAAACTGG - Intergenic
974573650 4:63688665-63688687 ACAAAGAAATTATCTGAAACTGG + Intergenic
974606396 4:64157210-64157232 AAAAAGAGATTATCTGAAACTGG - Intergenic
974625881 4:64428791-64428813 GAAAAGAGATTATTTGAAACTGG + Intergenic
974702823 4:65472998-65473020 TGAGAGAGATGATCTGAAACTGG - Intronic
974924206 4:68277533-68277555 GCAAAGAGATAATTTGAAATTGG + Intergenic
974931377 4:68364999-68365021 ACAAAGAGATGATCTGAAATTGG + Intergenic
976000853 4:80371510-80371532 GCAAAGACATAATCTAAAACTGG - Intronic
976141908 4:82001914-82001936 GCAAAGCGATGTTTTGAAACTGG + Intronic
976287642 4:83385502-83385524 ACAAAGAGATTGTCTGAAACTGG - Intergenic
976828724 4:89289022-89289044 ACAAAGGGATGATCTGAAAGTGG - Intronic
976842334 4:89446022-89446044 GCAAAGAGATGATCTGAAACTGG - Intergenic
977983894 4:103359844-103359866 GAAGAGAGATGATCTGAATCTGG + Intergenic
978085071 4:104641690-104641712 GCAAAGGGATGACCTCACAAAGG - Intergenic
978267147 4:106839876-106839898 GCAAAGAAATGACCTGAAACTGG - Intergenic
978492522 4:109323821-109323843 ACAAAGAGATGATCTGAAACTGG - Intergenic
979087142 4:116427876-116427898 GCTAAGAGATGATCTGAAACTGG + Intergenic
979373313 4:119914867-119914889 GCAAAGAGATGATCTGAAAATGG - Intergenic
979420809 4:120502873-120502895 GCAAAGAGATGATTTGAAACTGG - Intergenic
979610154 4:122681500-122681522 ACAAAGAGATTATCTGAGACTGG + Intergenic
980153780 4:129080322-129080344 GCAAAGAGATGGTCTGAAACTGG - Intronic
980233710 4:130076717-130076739 GTAAAGTGATGAGCTCAAACTGG + Intergenic
980383475 4:132057861-132057883 ACAAAAAGATTATCTGAAACTGG + Intergenic
980458218 4:133072815-133072837 GCAAAGACTTGACCTGAAACTGG + Intergenic
980458686 4:133076828-133076850 GCAAAGAGATGATCTGAAACTGG - Intergenic
980702746 4:136454395-136454417 GCAAAGAGATGATCTGAAATTGG + Intergenic
981191809 4:141872866-141872888 ACAAAGAGATGATCTGAAATTGG - Intergenic
981260001 4:142708202-142708224 GCAAAGAGATGATCTGAAACTGG + Intronic
981503178 4:145473923-145473945 ACAAAGAGATGGTCTGAAATTGG - Intergenic
981515500 4:145604800-145604822 GCAAAGGCATGACATGAAGCTGG - Intergenic
982024916 4:151242467-151242489 GCAAAGGGCAGAGCTGAGACTGG + Intronic
982132138 4:152239225-152239247 GCAAAGGGATGAGATAGAACTGG - Intergenic
982428920 4:155299098-155299120 GGAAAGAAATGACCTGAAACTGG - Intergenic
982505954 4:156218437-156218459 GCAACGAAATGACCTGAAACTGG + Intergenic
982797640 4:159664574-159664596 ACAAAGAGATGATCTGAAATTGG - Intergenic
982805189 4:159754732-159754754 GCAAAGAGATGGTCTGAAATTGG + Intergenic
982917284 4:161227914-161227936 ACTAATGGATGGTCTGAAACTGG - Intergenic
982936097 4:161477286-161477308 GCAAAAGGAAGATCTTAAAAAGG + Intronic
983075237 4:163317508-163317530 GCAAAGAAATGACATGAAACTGG - Intergenic
983812267 4:172077613-172077635 ACAAAGAGATTATTTGAAACTGG + Intronic
983952718 4:173661599-173661621 ACAAAGAGATGATTTGAAATTGG + Intergenic
984057084 4:174942888-174942910 ACAAAGAGATGGTCTGAAATTGG - Intronic
984436780 4:179719361-179719383 TGAGAGAGATGATCTGAAACTGG - Intergenic
984842591 4:184082037-184082059 GCAAAGGCAAGATCTGAACAAGG - Intergenic
985371675 4:189291922-189291944 ACAAAGAGATGGTCTGAAATTGG + Intergenic
985386318 4:189451902-189451924 GCAAAGAAATGATCTGAAACAGG + Intergenic
985617019 5:929091-929113 AGAAAGAGATTATCTGAAACTGG + Intergenic
986099663 5:4595663-4595685 ACAAAGAAATGACCTGAAACTGG + Intergenic
986582270 5:9278368-9278390 ACAAAGAGATTATCTGAAATTGG + Intronic
986601496 5:9477739-9477761 ACAAAGAGATGATCTAAAATTGG + Intronic
986837066 5:11650862-11650884 GCAAATAGATGATCTGAAACTGG + Intronic
986869297 5:12028411-12028433 ACAAAGAGATAATCTGAAATTGG - Intergenic
986900134 5:12421339-12421361 ACAAAGAGATGATCTGATACTGG + Intergenic
986949997 5:13071362-13071384 GCAAAGAGATAATGTGAAACTGG - Intergenic
986975334 5:13387553-13387575 ACAAAGAGATGGTCTGAAATTGG + Intergenic
987169531 5:15240059-15240081 ACAAGGGGATTGTCTGAAACTGG + Intergenic
987196856 5:15535694-15535716 ACAAAGAGATAATCTGAAATTGG + Intronic
987488500 5:18549154-18549176 ACAAAGAGATGATCTGAGACTGG - Intergenic
988310388 5:29549040-29549062 TCAAAGAGATGGTCTGAAATTGG - Intergenic
988448174 5:31311102-31311124 ACAAAGAGATGATGTGAAACTGG - Intronic
988688478 5:33548881-33548903 GCAATGGGATGATTTGAACAAGG - Intronic
989296912 5:39839169-39839191 ACAAATAGATGATCTGAAATTGG + Intergenic
989499430 5:42149010-42149032 ACAAAGAGATGGTCTGAAATTGG + Intergenic
989695815 5:44199869-44199891 ACAAAGAAATGACCTGAAACTGG + Intergenic
990213829 5:53508842-53508864 GCAAAAAGATTATCAGAAACTGG - Intergenic
991204766 5:64038214-64038236 GCAAAGAAATGACCTGAAACTGG + Intergenic
991631467 5:68660667-68660689 GGAAAGGCATGATGGGAAACTGG + Intergenic
992448435 5:76854605-76854627 GCAAAGAAATGACCAGAAACTGG + Intronic
992680065 5:79144515-79144537 GCAAAGGAATGATCTTGAATTGG - Intronic
992768610 5:80026458-80026480 GAAAAGGCATGATCTAGAACAGG + Intronic
993253176 5:85554140-85554162 ACAAAGATATGATCTGAAATTGG - Intergenic
993799821 5:92319174-92319196 ACAAAGAGATGATTTGAAATTGG + Intergenic
994073819 5:95629340-95629362 GCAAATAAATGACCTGAAACTGG - Intergenic
994384928 5:99120197-99120219 GCAAAGGGATGGCCTGCAAGGGG - Intergenic
994546675 5:101176270-101176292 GCAAAGAAATGAACTGAAACTGG + Intergenic
994580330 5:101633193-101633215 ACAAAGAGATGGTCTGAAATTGG - Intergenic
994592300 5:101788769-101788791 ACAAAGAGATGATCTGAAATTGG + Intergenic
995132682 5:108647237-108647259 GTAAAGAAATGATCTGAAACTGG + Intergenic
996157037 5:120114950-120114972 GCAAAGAGATGGTCTGAAACTGG + Intergenic
996159570 5:120145822-120145844 ACAAAGAGATGGTCTGAAATTGG - Intergenic
996338563 5:122411510-122411532 AAAAAGGGGTGATCTGAAATGGG - Intronic
996537865 5:124596986-124597008 GTAAAGCAATGATCTGAGACAGG - Intergenic
997016286 5:129938500-129938522 ACAAAGAGATTATCTGAAACTGG - Intronic
997159546 5:131593849-131593871 ACAAAGAGATTATCTGAAACTGG + Intronic
997857077 5:137381981-137382003 AGAAAGAGATTATCTGAAACTGG - Intronic
998208008 5:140173279-140173301 GCAGAGGGAAGAGCAGAAACAGG - Intergenic
998487618 5:142516923-142516945 ACAAAGAGTTGATCTGAAATTGG + Intergenic
999068274 5:148715594-148715616 GCAAAGAGATTATCTGAAACTGG + Intergenic
999571548 5:152925319-152925341 GCAAAGAAATGACCTGAAACTGG + Intergenic
999851293 5:155542067-155542089 ATAAAGGGATGATTTGAAGCAGG - Intergenic
999906090 5:156142792-156142814 GCAAATAAATGACCTGAAACTGG + Intronic
1000575131 5:162967214-162967236 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1000859483 5:166439137-166439159 ACAAAGGGATGATTTGAAATGGG + Intergenic
1001194957 5:169664020-169664042 ACAAAGAGATGGTCTGAAATTGG - Intronic
1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG + Intergenic
1001944538 5:175767715-175767737 GCAAAGAAATGACCTGAAACTGG - Intergenic
1002375959 5:178789353-178789375 GCAAAGGGCTGATGTGAGACTGG - Intergenic
1003000157 6:2324747-2324769 GCAAACAAATGACCTGAAACTGG + Intergenic
1003798257 6:9630462-9630484 ACAAAGAGAGTATCTGAAACTGG + Intronic
1004076929 6:12352055-12352077 AACAAGAGATGATCTGAAACTGG - Intergenic
1004165957 6:13256524-13256546 GCAAAAAGATGACCTAAAACTGG - Intronic
1004356879 6:14937393-14937415 GCAAAGTGTTCATCTGAAAAGGG - Intergenic
1005848977 6:29804521-29804543 GCAAAGACATGACCTGAAACTGG + Intergenic
1005869049 6:29959741-29959763 GCAAAAAAATGATCTGAAACTGG + Intergenic
1007021427 6:38525862-38525884 ACAAAAAGATTATCTGAAACTGG + Intronic
1007975349 6:46095407-46095429 GCAAAGAAATGACCTGAAATTGG - Intergenic
1008071182 6:47100596-47100618 GCAAAGGGATGATTTACAAATGG - Intergenic
1008104733 6:47429199-47429221 GCAAATAAATGACCTGAAACTGG - Intergenic
1008998823 6:57689437-57689459 GCAAAGAAATGACCTGAAACTGG - Intergenic
1009187309 6:60588816-60588838 GCAGAGAAATGACCTGAAACTGG - Intergenic
1009527509 6:64765061-64765083 ACAAAGAGATTATCTGAAATTGG - Intronic
1009579067 6:65508578-65508600 GCAAGGGAATGATGTGAACCTGG + Intronic
1009607842 6:65896773-65896795 ACAAAGAGGTTATCTGAAACTGG - Intergenic
1009791273 6:68404134-68404156 ACAAAGAAATAATCTGAAACTGG - Intergenic
1009826025 6:68866930-68866952 ACAAAGAGATGGTCTGAAATTGG + Intronic
1010678017 6:78767387-78767409 GCAAAAAGAAGATCTGAAACTGG + Intergenic
1011028648 6:82897216-82897238 TCAAAGTTATGATCTGAAACAGG + Intronic
1011348806 6:86400272-86400294 GCAAATAAATGATCTAAAACTGG - Intergenic
1011555836 6:88570641-88570663 ACAAAGAGATTATATGAAACTGG - Intergenic
1011586813 6:88934924-88934946 CAAATGGGATGATATGAAACTGG - Intronic
1012125343 6:95421210-95421232 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1012210152 6:96509483-96509505 GCAAAGAGATGGTCTGAAATTGG + Intergenic
1013904494 6:115198974-115198996 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1013970783 6:116015902-116015924 ACCAAGAGATTATCTGAAACTGG + Intronic
1014247540 6:119083457-119083479 ACAAAAAGATTATCTGAAACTGG - Intronic
1016264392 6:142214072-142214094 ACAAAGAGATTATCTGAAAATGG - Intronic
1016383900 6:143512638-143512660 ACAAGGAGATGATCTGAGACAGG + Intergenic
1016512892 6:144863546-144863568 ACAAAGAGATGATCTGAAATTGG + Intergenic
1016544669 6:145207696-145207718 GGAAAGTGATGAACTTAAACTGG - Intergenic
1016589433 6:145728647-145728669 GCAAAGAGATTATCTGAAACTGG + Intronic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1018155632 6:160983048-160983070 GCAAAGAGACGATCTGAAACTGG + Intergenic
1020730048 7:11869152-11869174 ACAAAGAGGTGGTCTGAAACTGG + Intergenic
1021519611 7:21526387-21526409 ACAAAGAGATGGTCTGAAACTGG + Intergenic
1021617633 7:22519517-22519539 ACAAAGGGATGGTTTGAAATTGG + Intronic
1021640439 7:22730928-22730950 GCAAAGGGATGATTAGAAGTTGG + Intronic
1021951861 7:25782885-25782907 GAAAAGGGATCATCTGAGACAGG + Intergenic
1022445620 7:30468348-30468370 GCAAATGGATGATGTCAAAGGGG + Intronic
1022703523 7:32782800-32782822 GCAAAGAAATGACCTGAAACTGG - Intergenic
1022712637 7:32865879-32865901 GCAATGTAATGACCTGAAACTGG - Intergenic
1022907763 7:34872926-34872948 GCAAAGAAATGACCTGAAACTGG - Intronic
1022910359 7:34895115-34895137 GCAAAGAAATGACCTGAAACTGG + Intergenic
1023690232 7:42778859-42778881 GCAAAGAGGTGGTCTGAACCTGG + Intergenic
1023709406 7:42975846-42975868 ACAAAGAGATGATTTGAAATTGG - Intergenic
1024084048 7:45878918-45878940 GCAAAGAGATTATCTGAAGCTGG - Intergenic
1024729115 7:52235069-52235091 GCAAAGAGATGATCTGAAACTGG + Intergenic
1026396386 7:69958632-69958654 GCAGAGTGACTATCTGAAACAGG - Intronic
1027341216 7:77210183-77210205 ACAAAGAGATTATCTGAAATTGG - Intronic
1027666413 7:81046810-81046832 ACAAAGAAATGATCTGAAACTGG + Intergenic
1027742862 7:82034403-82034425 GGAATGAGATGACCTGAAACAGG - Intronic
1027834776 7:83226975-83226997 TCAATGGGATGATCTGAATCTGG + Intergenic
1027959088 7:84920314-84920336 GCAAAGAGATGATCTGAAACTGG - Intergenic
1028207173 7:88031639-88031661 ACAAAGAGATTATCTGAACCTGG + Intronic
1028227823 7:88269636-88269658 CAAAAGGGCTGATCCGAAACAGG - Intergenic
1028289971 7:89053623-89053645 CAAAAGTGATCATCTGAAACAGG - Intronic
1028399724 7:90412021-90412043 GCACAGGGAAGTTCTGAATCTGG + Intronic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1029233319 7:99090091-99090113 GGAAAGGGATGGTGAGAAACAGG + Intronic
1029914828 7:104198593-104198615 ACAAAGAGATTATCTAAAACTGG + Intronic
1030000688 7:105057536-105057558 GCAAAAGGATCACCTGAGACAGG - Intronic
1030072851 7:105712455-105712477 ACAAAGAGATTTTCTGAAACTGG - Intronic
1030752071 7:113240949-113240971 GAAAAGAGATTAGCTGAAACTGG + Intergenic
1031182114 7:118432481-118432503 GCAAAGAGATAATCTGAAACTGG + Intergenic
1031360740 7:120845460-120845482 GTAAAGAGATGTTCTAAAACTGG - Intronic
1031478092 7:122247370-122247392 ACAAAGAGATGATCTGAAATTGG + Intergenic
1031583533 7:123505919-123505941 GCAAGGAGATGATCTGAAACTGG - Intronic
1031618317 7:123906156-123906178 GCAAAGAAATAACCTGAAACTGG - Intergenic
1031637504 7:124119580-124119602 GCAAAGGGATGGTTTGGAAATGG + Intergenic
1031792479 7:126125132-126125154 GCAAAGTGTTGATCTGACAAAGG - Intergenic
1031914186 7:127546784-127546806 TGAGAGAGATGATCTGAAACTGG - Intergenic
1032373126 7:131380140-131380162 GTACCGGGATGATATGAAACTGG - Intronic
1033063522 7:138129988-138130010 GCAAAGAAATGATCTGAAACTGG - Intergenic
1034145518 7:148867757-148867779 GCAAATAAATGACCTGAAACTGG - Intronic
1034212227 7:149373793-149373815 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1034334233 7:150310200-150310222 ACAAAGGGAGGATGTGAAAGAGG - Intronic
1034689358 7:153001464-153001486 GCAAAGAGAAGATCTAAAATTGG - Intergenic
1034876218 7:154726814-154726836 GCAAATAGATGATTGGAAACTGG - Intronic
1035547843 8:497508-497530 ACAAAGAGATGGTCTGAAATTGG + Intronic
1036209849 8:6833247-6833269 TCAAAGGGCTAATCTGAAGCTGG + Intronic
1036518374 8:9467559-9467581 ACAAAGTGATTATCTGAAATTGG + Intergenic
1036538388 8:9675845-9675867 CCTAAGGGATCATCTGAAATTGG - Intronic
1037411609 8:18604454-18604476 GCAAAGAAATGACCTAAAACTGG + Intronic
1037803789 8:22048805-22048827 GCAAATGGGTTATCTGAAGCGGG + Exonic
1038684258 8:29702047-29702069 GCAAAGAGATAATCTAAAACTGG + Intergenic
1039979697 8:42398250-42398272 GTAATGGAAAGATCTGAAACTGG + Intronic
1040091338 8:43401668-43401690 TCACAGGGATGGTCTGAAATTGG - Intergenic
1040097973 8:43466612-43466634 GTAAAGAAATGATCTGAAACTGG - Intergenic
1040401141 8:47051113-47051135 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1040721504 8:50329889-50329911 GGAAAGAGATGATCTGAAATTGG - Intronic
1041392466 8:57359260-57359282 GTAAAGAGATAATCTGAAACTGG + Intergenic
1041732336 8:61075300-61075322 GCAATGGGTTGATCCAAAACAGG + Intronic
1043030641 8:75130196-75130218 ACAAAGAGATGATTTGAAATTGG + Intergenic
1043214645 8:77570247-77570269 ACAAAGAGATGTTCTGAAATTGG - Intergenic
1043706586 8:83358275-83358297 GCAAGGAGCTGAACTGAAACAGG + Intergenic
1043779517 8:84313477-84313499 ACAAAGAGATGATTTGAAATTGG - Intronic
1044152610 8:88800418-88800440 ACAAAGAGATTAACTGAAACTGG + Intergenic
1045224348 8:100229937-100229959 AAAAAGGGATGATGTGAAAATGG - Intronic
1045234366 8:100337276-100337298 GCAAAGGGAGGAACAGAAAGAGG - Intronic
1045561754 8:103271000-103271022 GCAAAGAGATGATCTACAACTGG + Intergenic
1046063859 8:109174051-109174073 ACAAAGAGATGATTTGAAATTGG + Intergenic
1046735092 8:117768334-117768356 GAAAAGAGATGATCTAAAACTGG + Intergenic
1046826250 8:118695104-118695126 ACAAAGAAATGACCTGAAACTGG - Intergenic
1046878248 8:119279111-119279133 GCAAAGAAATGACCTGAAACTGG - Intergenic
1047923448 8:129658226-129658248 ACAAAGAGATGGTCTGAAATAGG - Intergenic
1047937805 8:129799103-129799125 GCAAATAGATGATCTGAAACTGG - Intergenic
1048213366 8:132475667-132475689 ACAAAGGGATGGTCTGAAATTGG + Intronic
1050109600 9:2200816-2200838 ACAAAGAGATGATCTGAAACTGG - Intergenic
1050288578 9:4130169-4130191 GCAAAGAAATGAGCTGAAACTGG + Intronic
1050415101 9:5408526-5408548 GCAAAGAAATGACCTAAAACTGG + Intronic
1050587091 9:7124068-7124090 TCAAAGGGGTGCTATGAAACAGG - Intergenic
1050939261 9:11439188-11439210 CCAAAGAGATTATCTTAAACTGG + Intergenic
1051025595 9:12607132-12607154 GCAAAGGGATGATCGGTGCCAGG - Intergenic
1051582802 9:18695452-18695474 GCAAAGACATAACCTGAAACTGG - Intronic
1051637423 9:19193609-19193631 ACAAAGAGATGATTTGAAATTGG - Intergenic
1051925147 9:22316562-22316584 ACAAAGAGATGATCTGAAACTGG + Intergenic
1052168114 9:25358186-25358208 ACAAAGAGATTATCTGAAACTGG - Intergenic
1052173880 9:25433287-25433309 ACAAAGAGATTATCTGAAACTGG - Intergenic
1052179442 9:25506042-25506064 GCAAAGAGATTATCTGAAACTGG - Intergenic
1052208370 9:25870613-25870635 GCAAGGAAATTATCTGAAACTGG - Intergenic
1052382671 9:27788758-27788780 GCAAAGAGATTACCTGAAATTGG + Intergenic
1053084132 9:35203733-35203755 GCAAGGAAATGACCTGAAACTGG + Intronic
1053125802 9:35580006-35580028 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1053423221 9:37994109-37994131 ACAAAGGGATAATATGAAAAAGG - Intronic
1053619584 9:39801958-39801980 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1053877754 9:42561274-42561296 ACAAAGAGATGATCTGAAATTGG + Intergenic
1053894902 9:42733092-42733114 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1054233940 9:62540420-62540442 ACAAAGAGATGATCTGAAATTGG - Intergenic
1054264574 9:62905485-62905507 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1054959442 9:70951433-70951455 GCAGAGGGATCATTTGAACCTGG - Intronic
1055335219 9:75226785-75226807 GCAAAGAAATGACCTGAAGCTGG - Intergenic
1055475255 9:76657039-76657061 GCAAAGAGAAGATCTGCACCAGG + Intronic
1055615373 9:78066671-78066693 TCAAAGAGATTATCTGAAACTGG - Intergenic
1056429013 9:86508123-86508145 CCAAAGGGATGAGCTGCAACTGG - Intergenic
1057642185 9:96835246-96835268 GCAAAGGGATAATCTAAAGATGG + Intronic
1057983175 9:99682373-99682395 GCAAAGAGATTATCTGAAACTGG - Intergenic
1058476724 9:105342293-105342315 ACAAAGGGATGATCTGTATCTGG - Intronic
1058500529 9:105610770-105610792 GCAAAGGGATTGCCTGATACGGG - Intronic
1059604895 9:115824131-115824153 GCAAAGAGATTATCTGAAACTGG + Intergenic
1059617637 9:115967941-115967963 GCAAAGAAATGACCTAAAACTGG - Intergenic
1060019513 9:120117058-120117080 GCAAATAAATGATCTGAAAATGG + Intergenic
1061891899 9:133626167-133626189 ACAAAGAGATGGTCTGAAATTGG - Intergenic
1186488640 X:9953601-9953623 GCAAAGAGATGATCTGAAACAGG - Intergenic
1186608675 X:11117288-11117310 GCAAATGGCTGATCTGGAGCTGG - Exonic
1187180605 X:16939895-16939917 GCAAAGAAATGACCTGAAACTGG - Intergenic
1187603688 X:20861027-20861049 ACAAAGAGATTATCTGAAACTGG + Intergenic
1187650040 X:21391844-21391866 CCAAAGAGATGGTATGAAACTGG - Intronic
1187843098 X:23509211-23509233 GCAAAGAAATGACCTGAAACTGG + Intergenic
1188183049 X:27079037-27079059 GCAAGGGGATAATTTGAGACTGG + Intergenic
1188387086 X:29574743-29574765 GCAAAGGGATGATCTGAAACTGG - Intronic
1188657551 X:32716988-32717010 GCAAAGAGATTATCTGAAACTGG + Intronic
1189141720 X:38613917-38613939 GCACAGGGCTCCTCTGAAACTGG - Intronic
1189431484 X:40950983-40951005 GCCAAGAAATGACCTGAAACTGG - Intergenic
1189858935 X:45252408-45252430 GCAAAGGAATGATATAAAGCTGG - Intergenic
1189869605 X:45368615-45368637 ACAAAGAGATGGTCTGAAATTGG + Intergenic
1190438136 X:50448259-50448281 CCAAATGGCTGATCTGAAATAGG + Intronic
1190506694 X:51133548-51133570 GCAAAGATAGGATCTGGAACTGG + Intergenic
1190772388 X:53526352-53526374 ACAAAGAGATTATCTGAAACTGG + Intergenic
1190982165 X:55465834-55465856 GCAGAAGTAGGATCTGAAACTGG + Intergenic
1190986533 X:55507348-55507370 GCAGAAGTAGGATCTGAAACTGG - Intergenic
1191873273 X:65768679-65768701 GCAAAGAGATGATCTGAAACTGG + Intergenic
1191877661 X:65812640-65812662 GCAAAGAGATGATCTGAAATTGG + Intergenic
1192066555 X:67891235-67891257 GCAAAGAGATAATCTGAACCTGG + Intergenic
1193143591 X:78054871-78054893 CCAAAGAGATAATCTGAAACTGG - Intergenic
1193226115 X:78986083-78986105 GCAAACAGATGATTTGAAACTGG - Intergenic
1193332876 X:80255638-80255660 GCAAAAAGATGATCTGAAACTGG + Intergenic
1193406368 X:81106968-81106990 GCAAATAAATGACCTGAAACTGG + Intergenic
1193412642 X:81183105-81183127 GCAAAGAAATGAACTGAAACTGG + Intronic
1193489756 X:82134479-82134501 GCAAACAGATTATCTGAAACTGG - Intergenic
1193491984 X:82161810-82161832 GCAAAGAGATATTCTGAAACTGG + Intergenic
1193861331 X:86672185-86672207 GCAAAGACACAATCTGAAACTGG + Intronic
1193930022 X:87542156-87542178 ACAAAGAGATGATTTGAAATTGG + Intronic
1194043400 X:88971050-88971072 ACAAAGAGATGATCTGAAATTGG - Intergenic
1194064120 X:89241154-89241176 ACAAAGAAATGACCTGAAACTGG + Intergenic
1194084658 X:89510601-89510623 GCAAAGAAATGTTCTGAAACTGG - Intergenic
1194352764 X:92840622-92840644 GAACAGAGATTATCTGAAACTGG - Intergenic
1194360400 X:92942521-92942543 GCAATGAAATGATCTGAAACTGG - Intergenic
1194418041 X:93637571-93637593 GCAAAGAAATGACCTGAAACTGG + Intergenic
1194459079 X:94143348-94143370 GCAAAGAAATGACCTGAAAGTGG - Intergenic
1194590736 X:95797338-95797360 GCAAAGAAATGATCTAAAACTGG + Intergenic
1194881244 X:99254166-99254188 GCAAAGAGATGATCTGAAACTGG - Intergenic
1194895211 X:99432113-99432135 GCAAAGAAATTACCTGAAACTGG + Intergenic
1194910156 X:99631436-99631458 GAACAGAGATGATCTGAAACTGG - Intergenic
1196384767 X:115137679-115137701 GTTAAGGAATGATCAGAAACTGG + Intronic
1196601379 X:117605144-117605166 GCAAAGAAATGCTCTGAAACTGG + Intergenic
1196920444 X:120580044-120580066 GGAAACAGATGATCTGACACAGG + Intergenic
1197075241 X:122345115-122345137 ACAAGGAGATGATCTGAAATTGG - Intergenic
1197372992 X:125647152-125647174 GCAATCAGATGGTCTGAAACTGG - Intergenic
1197385371 X:125795303-125795325 GTTAAGAAATGATCTGAAACTGG + Intergenic
1197510940 X:127368404-127368426 GCAAAGAAATGATGTAAAACTGG - Intergenic
1197595163 X:128455366-128455388 GCAAAGAGGTGGTCTGAAATTGG - Intergenic
1197758739 X:130013694-130013716 GCCAAGGGAGGAGCTGAAACTGG - Exonic
1198696790 X:139349425-139349447 GCAAAGGAATCATCTGACAAAGG - Intergenic
1199109205 X:143910291-143910313 GCAAAATGATGGTCTGAATCTGG - Intergenic
1199117469 X:144009128-144009150 GCAAAGAGAATATCTGAAAATGG - Intergenic
1199196056 X:145032360-145032382 TCAAAGAGATAATCTGAAACTGG + Intergenic
1199223547 X:145344514-145344536 GCAAAGAAATGACCGGAAACTGG - Intergenic
1199243780 X:145578700-145578722 AGAAAAGGATGAACTGAAACAGG - Intergenic
1199373709 X:147083006-147083028 GCAAAGAGATTTTCTGAACCTGG + Intergenic
1199699092 X:150363409-150363431 GCCAGGGGGTGATCTGCAACAGG + Exonic
1199931912 X:152531402-152531424 ACAAAGAGATTATCAGAAACTGG - Intergenic
1200353662 X:155525931-155525953 GCAAAGAGATGGTATGAAATTGG + Intronic
1200395299 X:155982930-155982952 ACAAAGAGATGGTCTGAAATGGG + Intergenic
1200437304 Y:3166487-3166509 GCAAAGAAATGTTCTGAAACTGG - Intergenic
1200661067 Y:5957364-5957386 GAACAGAGATTATCTGAAACTGG - Intergenic
1200718294 Y:6575253-6575275 ACAAAGAAATGACCTGAAACTGG + Intergenic
1201708308 Y:16961060-16961082 GCAAAGGGATAATTTGACAGAGG + Intergenic