ID: 1188391785

View in Genome Browser
Species Human (GRCh38)
Location X:29630157-29630179
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 2, 1: 4, 2: 19, 3: 67, 4: 453}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188391775_1188391785 27 Left 1188391775 X:29630107-29630129 CCAGCAGATTCAGTGTCTGGTGA 0: 171
1: 517
2: 937
3: 1249
4: 1575
Right 1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG 0: 2
1: 4
2: 19
3: 67
4: 453
1188391777_1188391785 -6 Left 1188391777 X:29630140-29630162 CCTCATAGACAGCCCTCCCTCAC 0: 1
1: 0
2: 1
3: 16
4: 215
Right 1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG 0: 2
1: 4
2: 19
3: 67
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900804078 1:4755925-4755947 CGTCACCTGGGGAAGGGTGAAGG + Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
900874175 1:5329802-5329824 CCTCACATGGTGGAAGGGGAAGG + Intergenic
900893587 1:5467171-5467193 CCTCACATGGGGCTGGCAGATGG - Intergenic
901528035 1:9836234-9836256 CCACACATGGTGGAGGGCGGGGG + Intergenic
902566327 1:17314091-17314113 CCTCAAGAGGGGAAGGGAGAAGG - Intronic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903336094 1:22625788-22625810 CCTGACAAGGTAAAGGGAGGAGG + Intergenic
903811698 1:26038329-26038351 CCTGACATGGTGGAGGGAAAGGG - Exonic
905945395 1:41897452-41897474 CCTCAGATGGTGGAGGGGTAGGG - Intronic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
907971849 1:59390801-59390823 AGTCACAAGGTAAAGGGAGAAGG + Intronic
908454666 1:64291469-64291491 CCTCACATGGTGGAGAGAGAGGG + Intergenic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
913050289 1:115111658-115111680 CCTCACATGGTAGAAGGGGAAGG - Intergenic
913120273 1:115733818-115733840 CTTCACACGGTTAAGGGAAATGG - Intronic
913225239 1:116693345-116693367 CCTCAGAGGGTGAAGGGGGGAGG - Intergenic
913313566 1:117530060-117530082 CCTCACATGGTAGAAGGCGAAGG + Intergenic
913348218 1:117829138-117829160 CCTTACATGGTGAAAGAACAAGG + Intergenic
913448482 1:118975040-118975062 CATCCCATTGTGAATGGAGAAGG + Intronic
915008786 1:152665144-152665166 CCTCTCAGTGTGAAGGGAAAAGG + Intergenic
915538150 1:156550145-156550167 CCACAGAGGTTGAAGGGAGAGGG + Intronic
915643231 1:157246128-157246150 AGTCACAAGGTGAAGGCAGAAGG - Intergenic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
916210009 1:162352677-162352699 CCTCACAGGGTGGAAAGAGAGGG + Intronic
917170425 1:172167067-172167089 CCTGACATGGGGTGGGGAGATGG - Intronic
917231992 1:172847216-172847238 CCTCATTTGTTAAAGGGAGATGG - Intergenic
918356589 1:183710660-183710682 CTTCACATGGTGGCAGGAGAGGG + Intronic
919252070 1:195068406-195068428 CCTCACATGGTAGATAGAGAAGG - Intergenic
921297985 1:213722620-213722642 CCTCCACTGGGGAAGGGAGATGG - Intergenic
923379731 1:233404133-233404155 CCACTCATGGTGAAAGGTGAAGG - Intergenic
924672790 1:246146868-246146890 CCTCCCTTGGTGAAGGTTGATGG + Intronic
924814050 1:247427154-247427176 CCTTACATGGTGAAGAGGCAAGG + Intronic
924897187 1:248352823-248352845 CCTCACAAGGGGAAGACAGAAGG + Intergenic
1063230951 10:4065201-4065223 CCTCACAGGGTGGAAGGAGTGGG - Intergenic
1063908572 10:10806054-10806076 CTTTAGATGGTGAAGTGAGAAGG + Intergenic
1064796740 10:19020531-19020553 CCTCACATGGTGGAGAAAGAGGG + Intergenic
1064885903 10:20112046-20112068 CCTCACATGGTATATGCAGATGG - Intronic
1065456169 10:25908882-25908904 CCTCCCATGATCAAGGGAGGAGG - Intergenic
1065704486 10:28459689-28459711 TCTCTCTTGGTGAAGGGGGAAGG - Intergenic
1067366012 10:45629401-45629423 CATCACTTTTTGAAGGGAGAAGG + Intronic
1067532570 10:47085336-47085358 TCTCACAGGGTGAAGGGGGCAGG - Intergenic
1067668843 10:48301609-48301631 CCTCACATGGCACAGTGAGAGGG - Intergenic
1067822367 10:49541144-49541166 CCTTACATGGGGTAGAGAGAGGG + Intergenic
1067944236 10:50680249-50680271 CCTCACATGGGGCTGGGGGAAGG + Intergenic
1068335755 10:55630808-55630830 CTTCACATGGTGGGTGGAGAGGG + Intergenic
1068434355 10:56971499-56971521 CCTTACATGATCAAAGGAGATGG - Intergenic
1068659961 10:59613525-59613547 CCTCACATGGGAAGGGGTGAGGG + Intergenic
1068708806 10:60108881-60108903 CCCCCCATGGTGGAAGGAGAGGG - Exonic
1069539014 10:69279269-69279291 CCTCATGTGGTGAAGGGCGTTGG + Intronic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070583572 10:77743474-77743496 CCTCACATGGTAAAGGGGTGAGG - Intergenic
1070745719 10:78932531-78932553 CCTCACAGGGTGCAGTGTGATGG + Intergenic
1070754304 10:78982116-78982138 CCTCACATGCTGCAGGGAGGTGG + Intergenic
1071071152 10:81696031-81696053 TCTCACATGGTGAAAGGGGTAGG + Intergenic
1071646080 10:87361558-87361580 CCTCACATGGGGCCGGGGGAAGG + Intronic
1071860232 10:89664828-89664850 CCTCACATGGTGGAAGGAGCAGG - Intergenic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1073353305 10:102835006-102835028 CCTGACAAACTGAAGGGAGAGGG + Exonic
1073516163 10:104077471-104077493 CCTCTCTTGGTGGAGGGAGCCGG - Exonic
1074193188 10:111155728-111155750 CCTCACTTGGTGAGGAGAGGAGG - Intergenic
1074586737 10:114775096-114775118 CTTCACATGGTGGCAGGAGAGGG + Intergenic
1076382647 10:130035965-130035987 CTTCACCTGGTGGAGAGAGAGGG + Intergenic
1076871209 10:133195981-133196003 CGTCGCATGGGGAAGGGAGTGGG + Intronic
1077013494 11:390211-390233 CCTGACATGGTGGAGGAAGGAGG - Intergenic
1077907092 11:6543062-6543084 CCTCACATGGGGAAGAGTAAGGG + Intronic
1077998928 11:7477177-7477199 TCTCACATGGTGGAGAGAGAGGG - Intergenic
1078398207 11:11000807-11000829 GCCCACATGGTGGAGAGAGAGGG + Intergenic
1078432055 11:11295624-11295646 CCTCTCAGGGTGGAGGGAGGTGG + Intronic
1078625422 11:12951511-12951533 CCTCATATGGTGAACAGAAAGGG - Intergenic
1078723518 11:13906203-13906225 CCACTCATGGTGAAAGGGGAAGG + Intergenic
1078961444 11:16277308-16277330 CCTCACATGGTGGAGTGGGTGGG - Intronic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1080695931 11:34602958-34602980 CCTCACTTGTTAAAGGGAAAGGG + Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082753565 11:57048894-57048916 CCACAGATGCTGAAGGGAGCAGG + Intergenic
1082908415 11:58340183-58340205 GTACACATGGTGAGGGGAGAGGG + Intergenic
1083470308 11:62879927-62879949 CCTAACATAGTGAAGTGATAGGG + Intronic
1083546814 11:63554991-63555013 ACTGACATTGTAAAGGGAGATGG + Intronic
1083721646 11:64606563-64606585 CCTCTCCTGGTGAGGGGAGTTGG + Exonic
1084166296 11:67376239-67376261 CCCCACTAGGTGAGGGGAGAGGG - Intronic
1085346194 11:75769389-75769411 CTCTACCTGGTGAAGGGAGAGGG - Intronic
1085481941 11:76830096-76830118 CCCCACATGAGGAGGGGAGAAGG - Intergenic
1086051831 11:82601276-82601298 CCTCACATGGGAAGGGGCGAGGG + Intergenic
1086168304 11:83806108-83806130 CCTGACCTGGACAAGGGAGAAGG - Intronic
1086373943 11:86181578-86181600 CCTGGCATGTTGAAGGAAGATGG + Intergenic
1086504774 11:87493864-87493886 CCTCAGAAGGTGACTGGAGAGGG - Intergenic
1086943341 11:92820572-92820594 GCTCACATGGTGAGGGGTCAAGG + Intronic
1087897423 11:103602213-103602235 CCTGATTTGGTGAAGGGACATGG - Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1088162059 11:106884032-106884054 CCTGTCATGGGGAAGGGGGAGGG + Intronic
1088340926 11:108765806-108765828 CATTACTTGGTGAAGTGAGAAGG + Intronic
1088393262 11:109339483-109339505 CCTCACATAATGAAGAAAGATGG - Intergenic
1090873761 11:130770684-130770706 CCTCACATGGATAAGGCACACGG + Intergenic
1090882946 11:130850202-130850224 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1090941797 11:131393610-131393632 CCTCCCAGGGTGAACAGAGAGGG + Intronic
1092068874 12:5616321-5616343 CCTCTCATGGTCAAGGGGAAAGG + Intronic
1092293484 12:7179901-7179923 CATCACATGGTGAAAGGGCAAGG + Intergenic
1092817763 12:12326198-12326220 CCTGCCATGATGAGGGGAGAAGG - Exonic
1093288042 12:17290076-17290098 CCTCACATGGTAGAGAGAGAAGG + Intergenic
1094458452 12:30666020-30666042 CCTCTCCTGGTGAGGGGAAAGGG - Intronic
1095174832 12:39079690-39079712 CCTCACATGGTGGAAGGATCTGG + Intergenic
1095943822 12:47742453-47742475 CCCCACTTCCTGAAGGGAGAAGG + Intronic
1096692143 12:53327946-53327968 AGTCTCATGGTGAAGAGAGAAGG + Exonic
1097721015 12:63021544-63021566 CCTCAAATGGTAATGGGAAATGG + Intergenic
1098489560 12:71059678-71059700 CCTCACATGATGAAAGCAGCGGG + Intronic
1098761737 12:74433933-74433955 CTTCACATGGTGGCAGGAGAGGG - Intergenic
1098940046 12:76523638-76523660 CCTCACATGGTGGAAACAGAGGG - Intronic
1099475738 12:83105524-83105546 CTTCACATGGTGAAAGCAGGAGG + Intronic
1099969241 12:89483484-89483506 CCTCACATGGTGAGAGGCAAGGG + Intronic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1100399941 12:94220747-94220769 CCAGACATGGTGGAGGGGGAAGG + Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102414322 12:112747305-112747327 CCTCACATGGTGGAAGGGCAAGG - Intronic
1102528428 12:113528653-113528675 CCTGACAGGGGGAAGAGAGAGGG - Intergenic
1104729753 12:131098278-131098300 TTTCCCATGATGAAGGGAGAGGG + Intronic
1105239405 13:18596920-18596942 GCTGAAATGGTGAAGGGTGATGG + Intergenic
1105308481 13:19185722-19185744 CATCACATGGTGGAGAGAGAAGG - Intronic
1105577531 13:21668001-21668023 CCACACATGGAGTAGGCAGAGGG + Intergenic
1105632076 13:22179360-22179382 CCTCACAGGGTGGAGAGAGGAGG + Intergenic
1106580767 13:31016571-31016593 GCTCACGTGGTGAGGGGTGAGGG + Intergenic
1106769543 13:32948555-32948577 CCTCCCATGGGGAAGCAAGAAGG - Intergenic
1107210067 13:37842635-37842657 TCCCACATGGTGAAAGGAGCAGG + Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108677597 13:52750680-52750702 CCTCACATGGTGGAGAGGGTGGG - Intergenic
1109752884 13:66719445-66719467 CCTCACATGGTGGAGGGCCCAGG - Intronic
1110062555 13:71061555-71061577 CTTCACATGGTGGCAGGAGAGGG + Intergenic
1111715109 13:91869817-91869839 CTTCACATGGTGACAGCAGAGGG + Intronic
1111931416 13:94516718-94516740 CATCACATGGTGAGGGGGGGTGG - Intergenic
1111990172 13:95108575-95108597 CCTCACATGGTGGAAGGTGAAGG - Intronic
1113329695 13:109316401-109316423 CTTCACATGGCAATGGGAGAGGG + Intergenic
1113651656 13:112037485-112037507 ACTCGCACGGGGAAGGGAGAAGG - Intergenic
1114757042 14:25270929-25270951 TCTCACATGGTGAAAGGTGGAGG + Intergenic
1115140678 14:30167972-30167994 CATCACATGGTGAAAGCAGGAGG + Intronic
1115143087 14:30196528-30196550 CCTCACATGGTGGCGGGCAAAGG - Intergenic
1115767593 14:36639507-36639529 GCTCACATTGTGAGGCGAGAGGG - Intergenic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1116089495 14:40286815-40286837 TTTCACAAGGTCAAGGGAGAAGG - Intergenic
1117011135 14:51471934-51471956 CCTCACATGGCAGAGGCAGAAGG - Intergenic
1117070266 14:52049817-52049839 CCACTTCTGGTGAAGGGAGAGGG + Intronic
1118318499 14:64739740-64739762 CCTCACATGGCAAAGGGGCAAGG + Intronic
1118781175 14:69008934-69008956 CCTCACTTGGAGGAGAGAGATGG + Intergenic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1120351141 14:83359662-83359684 CCTGACATGGTACAGTGAGAAGG + Intergenic
1120454009 14:84708446-84708468 CCACATGTGGGGAAGGGAGATGG - Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121464501 14:94106119-94106141 CCTCACATGGTAGTGGGATAAGG + Intronic
1121862249 14:97329453-97329475 CCTCACAGGGTGGAGGGATCAGG + Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122742573 14:103880722-103880744 CCTCCCATGACGAAGGGAGGTGG - Intergenic
1122866937 14:104610498-104610520 CATCTCATGGTGGAGGCAGAAGG - Intergenic
1123049372 14:105533280-105533302 CCCCAGATGGTGAAGAAAGATGG - Intergenic
1123670744 15:22654404-22654426 CCTCACTTGGTGAAAGGGGCAGG - Intergenic
1123880797 15:24676242-24676264 GCTCACGTGGTGAAGGCAGCAGG - Exonic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1124803924 15:32862003-32862025 CCCCACATGATCAAAGGAGAGGG + Intronic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1125685337 15:41560094-41560116 CCTGAGAGGGTGAAGGGAGCAGG + Intronic
1125772599 15:42179997-42180019 CTTCACATGGTGGAAGGAGAAGG - Intronic
1125966538 15:43879828-43879850 CCTCGCGTGTTGCAGGGAGAAGG + Intronic
1127122683 15:55785258-55785280 CCTCTTCTGGTGGAGGGAGACGG - Intergenic
1128612342 15:69084229-69084251 TCTGACATGGTGGGGGGAGAGGG - Intergenic
1130189640 15:81721410-81721432 CCTCACAAGGTGGCAGGAGAAGG - Intergenic
1130562742 15:84971524-84971546 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131152131 15:90053838-90053860 CCTCACCTAGGGAAGGGAGGAGG - Intronic
1132553433 16:562786-562808 ACTCACATGCTGTGGGGAGATGG + Intronic
1133441144 16:5821823-5821845 CCTCACATGGTGAAAGGAGAAGG + Intergenic
1134384338 16:13757943-13757965 CATCCCATGGTGAAAGTAGAAGG - Intergenic
1135485834 16:22863838-22863860 CCACAAAGGATGAAGGGAGAGGG - Intronic
1135568163 16:23528041-23528063 CCTCACGTGGTGGAGGGACGAGG - Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1135890911 16:26356368-26356390 CTTCTCATGGTGAAAAGAGAGGG + Intergenic
1136403245 16:30029745-30029767 CCACAAATGGGGAAGGAAGAAGG - Intronic
1136615501 16:31395881-31395903 AGTCACATGAGGAAGGGAGAGGG - Intronic
1137595158 16:49718738-49718760 CCTCACATGGTGGAAGGAGCTGG + Intronic
1138087436 16:54145587-54145609 CCTCACAGGGTGGAGGGTCAAGG - Intergenic
1138690163 16:58760105-58760127 CTTCACATGGCGACAGGAGAGGG + Intergenic
1139327610 16:66164320-66164342 CCTCAAATGGGGCAGGGGGAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139952412 16:70678759-70678781 CCTCACAAGGTCCAGGGAGGTGG + Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140694030 16:77514082-77514104 CCTCACATGGTGGAAGGAATGGG + Intergenic
1141007374 16:80364899-80364921 CCTCTCATGGTGACGGCAGAGGG - Intergenic
1141030038 16:80579628-80579650 CCTCACATGATGGAAGGAGCAGG - Intergenic
1141700536 16:85640134-85640156 CCACCCATGGTGCAGGGAGCTGG + Intronic
1142373499 16:89695581-89695603 GCTCACAGGCTGCAGGGAGAAGG - Exonic
1143201177 17:5114873-5114895 CCTCACATGGCAGAGAGAGAGGG - Intronic
1143316897 17:6039725-6039747 CCTCACATGGTGGAAGGTGGAGG + Intronic
1144237359 17:13274510-13274532 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1146414788 17:32621860-32621882 CCTCACATGGGGAAGAGAGGAGG - Intronic
1146549721 17:33769849-33769871 CCTCACATGGTGAAGAGCAGAGG + Intronic
1146625334 17:34431007-34431029 GCTCACATGGTGAGGGGTGGGGG - Intergenic
1146920910 17:36710535-36710557 CCATACATGGTGAATGGGGATGG - Intergenic
1147263021 17:39219779-39219801 CCTCTCAACGGGAAGGGAGACGG - Intronic
1148694369 17:49550169-49550191 CCTCAGGTGGTGTAGGGAGCAGG - Intergenic
1150644686 17:66970606-66970628 GCTCACATGGTGGAGAGAGAGGG + Intronic
1151775403 17:76197948-76197970 CCTCCCATCTTCAAGGGAGAGGG - Intronic
1153583061 18:6594726-6594748 CCGCTCATGGGGAAGGCAGAAGG + Intergenic
1153725174 18:7946961-7946983 ACTCACAGGATGGAGGGAGAGGG - Intronic
1154449383 18:14461701-14461723 GCTGAAATGGTGAAGGGTGATGG - Intergenic
1155347627 18:24874399-24874421 CATCACATGGGCAAGAGAGAGGG + Intergenic
1155374406 18:25139915-25139937 CCTTACTTGGTGAAGGGGCAAGG - Intronic
1155429842 18:25743849-25743871 CCCCACCTGGTGAGGGGGGATGG - Intergenic
1158013324 18:52754485-52754507 CCTCACATGGTGAAAGGAGCAGG - Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1158249912 18:55476291-55476313 CCTCACAAAGTGAAGAGTGAAGG + Intronic
1158703169 18:59767298-59767320 CCTCACATGGTGGAAGGCGCTGG - Intergenic
1159946108 18:74445906-74445928 CCTAGCTGGGTGAAGGGAGAGGG + Intronic
1160134757 18:76262701-76262723 CATAACATCGTGAAAGGAGAGGG - Intergenic
1160417522 18:78721439-78721461 CTTCAGAAGGGGAAGGGAGAGGG + Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1164684476 19:30157839-30157861 CCTCACGTGGTGAAGGCAGAAGG - Intergenic
1165489289 19:36114110-36114132 CCTCACTGGGCGAAGGGAGGAGG - Intronic
1166051235 19:40261583-40261605 CGTCCCATGGTGAAAGGGGAAGG - Intronic
1167636782 19:50659980-50660002 CCTGACATGGTGAGGGGAGGGGG + Intronic
1167800151 19:51735388-51735410 CCTCACATGGTGGTGGGGGCAGG + Intergenic
925417473 2:3680690-3680712 GCTCACATGCTGTAGGGAAAGGG + Intronic
926426890 2:12746378-12746400 CCTCACATGGAAGAGAGAGAGGG + Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
930827056 2:55705417-55705439 CCTCACGTGATGAGGAGAGAGGG - Intergenic
930851743 2:55968471-55968493 CCTCACATGGTGGAGGGGTGGGG - Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931047067 2:58366415-58366437 CTTCATATGGTGGAGAGAGATGG - Intergenic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
932718024 2:74116994-74117016 CCTCAAATGGGCAAGGGAGAGGG + Intergenic
933485812 2:82922304-82922326 CCTCCCATTGGGATGGGAGAAGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935463659 2:103368805-103368827 ACTCACATGGTAAAAGGTGAGGG + Intergenic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
936615614 2:114044848-114044870 CCTTACATGGTAGAGAGAGAAGG + Intergenic
937658784 2:124407569-124407591 CTTCACAGGGGAAAGGGAGATGG + Intronic
938263352 2:129910357-129910379 TATGACATGGTGATGGGAGAGGG - Intergenic
938786249 2:134632627-134632649 CCTCAAAGGGTGGAAGGAGAGGG + Intronic
939566278 2:143789909-143789931 CTTCACAGGGGAAAGGGAGATGG + Intergenic
939979018 2:148756728-148756750 CCTCACAGAGGGAAGAGAGAAGG - Intronic
940409933 2:153349818-153349840 CCTCTAGTGCTGAAGGGAGATGG - Intergenic
942613141 2:177762668-177762690 GCTAACATGGGGGAGGGAGAAGG + Intronic
943759085 2:191588940-191588962 CCTCACATGGAGAAAGGTCAAGG - Intergenic
944965486 2:204927348-204927370 CCTTGCATGGTGGAAGGAGAAGG - Intronic
946735676 2:222752115-222752137 CCTCACATGGTGAAACGTTAAGG - Intergenic
947154803 2:227151784-227151806 CCTCACATGGTGGAAGGAAGGGG - Intronic
947944513 2:234090135-234090157 CCTTACATGGTAAAAGGGGAAGG - Intergenic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
948704608 2:239781106-239781128 CCTCAAATGGTCAAGGGGCAAGG + Intronic
948934411 2:241153312-241153334 CCTCAAATGGTGCTGGGACATGG + Intronic
948943850 2:241209668-241209690 CCCCACATGGTGCAGGAGGATGG - Intronic
1168760218 20:345577-345599 CCCCAAATGGTGACAGGAGATGG - Intergenic
1169334929 20:4748378-4748400 GAGCACATGGGGAAGGGAGAAGG + Intergenic
1169492971 20:6086745-6086767 CTTCACATTGTGACAGGAGAGGG - Intronic
1169606277 20:7323134-7323156 CCTCACATGGTGGAGGGTGAGGG + Intergenic
1169729680 20:8773133-8773155 CATCACATGGGGAAGGGAGTTGG - Intronic
1170051520 20:12150809-12150831 CCTCACATGGCAGAGAGAGAAGG + Intergenic
1170582767 20:17711502-17711524 CCTGACCTGGTGAAGGAAGCAGG + Intronic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1170976256 20:21167406-21167428 GCTCAGATGGTGAAGGTATAAGG - Intronic
1170985218 20:21251631-21251653 CCTGACATGCTGCCGGGAGACGG + Intergenic
1171105216 20:22426878-22426900 CCCCACCAGGTGAAGAGAGATGG - Intergenic
1171481571 20:25459251-25459273 CACCACATGGTGGAGGAAGAGGG + Intronic
1172743014 20:37184065-37184087 AATCACATGGGGAAGGGCGAGGG - Intronic
1172911952 20:38416130-38416152 CCTCATATGGTGGAGAGCGAGGG - Intergenic
1173185307 20:40835940-40835962 CCTGGCATGGAGAAGGGTGATGG + Intergenic
1173958788 20:47055388-47055410 CCACACTGGGTGAAGGCAGATGG + Intronic
1174650416 20:52120101-52120123 CCACACATGGTGGAAGGGGAAGG - Intronic
1175607718 20:60324556-60324578 CCTCACATTGTTAAGTGAAAAGG + Intergenic
1175656028 20:60771902-60771924 TCTCCCACTGTGAAGGGAGAAGG + Intergenic
1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG + Intergenic
1175868032 20:62191800-62191822 GTGCTCATGGTGAAGGGAGAGGG + Intronic
1176043105 20:63076466-63076488 CCGCTCATGGTGAAAGGTGAAGG + Intergenic
1176160419 20:63644776-63644798 CCTCACATGATGGAAGGTGAGGG - Intronic
1176446789 21:6828673-6828695 GCTGAAATGGTGAAGGGTGATGG + Intergenic
1176718517 21:10374610-10374632 CCTTACATGGTAAAGGTGGAAGG - Intergenic
1176824960 21:13693699-13693721 GCTGAAATGGTGAAGGGTGATGG + Intergenic
1177486043 21:21757573-21757595 CCTCACATGGCAAAGGCAGAAGG + Intergenic
1178047199 21:28709055-28709077 CCTCACATGGTGAAAAGAGCTGG + Intergenic
1179604790 21:42507708-42507730 CCTCACATAGTGAGAGGGGAAGG + Intronic
1180006054 21:45021234-45021256 CCTCAGCTGGTGCAGGGAGTTGG - Intergenic
1180093835 21:45545424-45545446 CCACACATGGTGGAAGGTGACGG - Intergenic
1180258007 21:46646935-46646957 CCTCACGTGGTGAAGGCGGGAGG + Intronic
1180927061 22:19562804-19562826 ACCCACATGGTGATGGGAGTGGG - Intergenic
1181359534 22:22323777-22323799 CCCCAGATGGTGGAGGGAGGTGG + Intergenic
1181369614 22:22405521-22405543 CCCCAGATGGTGGAGGGAGGTGG + Intergenic
1181405096 22:22678776-22678798 CCTGTCATGGTGAAAGGTGAAGG + Intergenic
1181408247 22:22700421-22700443 CCTGTCATGGTGAAAGGTGAAGG + Intergenic
1181936273 22:26441174-26441196 CTTCACATGGTGAAAGGAGGTGG + Intronic
1181967370 22:26666669-26666691 CCTTAAAAGGTGAGGGGAGAAGG - Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182716887 22:32364097-32364119 GCTGACAGGGTGAAGGGAGTGGG - Intronic
1184507819 22:44914693-44914715 CCTCACGTGGTGGATGGGGAAGG + Intronic
1184810097 22:46825384-46825406 CATCTCCTGGTAAAGGGAGACGG - Intronic
1184824035 22:46934910-46934932 GCTTGCCTGGTGAAGGGAGAGGG + Intronic
1185019734 22:48367146-48367168 CCTCACATGGAGGAAGGAGGAGG + Intergenic
1185163877 22:49245742-49245764 CCTCACATGGTGGATAGAGGGGG + Intergenic
1185315785 22:50178525-50178547 CCTCAAAGGGGGAAGGGAGGAGG + Intronic
949122613 3:404989-405011 CCTCACATCGTGAAAGGGGTAGG + Intronic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949981765 3:9506429-9506451 GATCTCATGGGGAAGGGAGAGGG - Intronic
950095918 3:10330367-10330389 CCTCACAGGGTGCAGAGGGACGG + Intronic
950239310 3:11353739-11353761 CCACTCATGGTGAAAGGTGAAGG - Intronic
950704705 3:14772679-14772701 CCTCACCTGTGCAAGGGAGAGGG + Intronic
950867887 3:16203935-16203957 CCTCACATGGAGAGGAGAGGGGG + Intronic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
951966959 3:28398211-28398233 CCTCACATGGTGAAGAGTCGAGG + Intronic
952122925 3:30266033-30266055 CCACTCATGGTGAAAGGTGAAGG - Intergenic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
952989431 3:38818813-38818835 CCTCAGATGGTGAAGGCATTTGG - Intergenic
953704314 3:45219821-45219843 CCACACATGGTGAAGGGGTTCGG + Intergenic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956704921 3:71991484-71991506 CCACTCATGGTGGAAGGAGAAGG + Intergenic
956784662 3:72632553-72632575 GCTCACATGGTGGAGAGAAAGGG + Intergenic
956976309 3:74584477-74584499 CGTCACATGGTGAGAGTAGAAGG - Intergenic
957258313 3:77867404-77867426 GCTCACATGGTGGAAGCAGAAGG + Intergenic
958461142 3:94397511-94397533 CTTCACATGGTGAAGACAGAAGG - Intergenic
958836021 3:99146018-99146040 CCTCACATGGTGGAAGGCAATGG - Intergenic
959345446 3:105189007-105189029 CCTGAAATGTTTAAGGGAGATGG - Intergenic
959515073 3:107256693-107256715 CCACACATGGTGGAAGAAGAGGG + Intergenic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
959863737 3:111243137-111243159 CCTCACCTGGAGATGGGAGCAGG + Intronic
960514443 3:118588285-118588307 CCACTCATGGTGGAGGGGGAAGG - Intergenic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
961501853 3:127341980-127342002 CTTCCCATGGTGCAGGGACACGG - Intergenic
961574176 3:127821739-127821761 CCTCACCTGGTCAATGCAGACGG - Exonic
961870822 3:129986824-129986846 CCTCTCATGGTGGAAGGTGAAGG - Intergenic
961871219 3:129989735-129989757 CCTCTCATGGTGGAAGGTGAAGG - Intergenic
961945855 3:130686971-130686993 CCTCACATGATGCACTGAGAAGG - Intronic
963173724 3:142277380-142277402 CCTCACGTGGTGAAAGGCAAAGG - Intergenic
963229042 3:142891415-142891437 CCTCACAGGGTGATAGGAGAAGG + Intergenic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
963828246 3:149979212-149979234 CTTCACATGGTGGAGCGGGAGGG - Intronic
963989368 3:151635419-151635441 CCTCACATGGTGGAAGGGGAGGG + Intergenic
964341032 3:155708417-155708439 CCTCTCATGGTGTAGCCAGAAGG + Intronic
965928211 3:174009142-174009164 CCTCACATGGTTAAGAGAGAAGG + Intronic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
966139066 3:176734254-176734276 CCTCACAGGGCAGAGGGAGAGGG - Intergenic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
969455713 4:7298604-7298626 GCTCCCACGGTGACGGGAGAGGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970034396 4:11716071-11716093 ATTCACCTGGAGAAGGGAGAGGG - Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970809226 4:20072030-20072052 CCACTCATGGTGGAAGGAGAAGG + Intergenic
971140881 4:23923725-23923747 CCTCAGATGGAAAAGGAAGAGGG + Intergenic
971222081 4:24717553-24717575 CCTCACATGGTGGACAGGGAAGG - Intergenic
971360885 4:25937386-25937408 CATCCCATGGTGAAGGCAAAAGG + Intergenic
971774868 4:30950103-30950125 CAACACCTGGGGAAGGGAGATGG - Intronic
971903687 4:32697593-32697615 CCTCACATGGTGGAAGGAAGGGG - Intergenic
972366316 4:38378369-38378391 TCTCACAGGGTGAAGAGAAAAGG + Intergenic
972404140 4:38730708-38730730 CCTCTCATGGTGGTGGGAGGAGG - Intergenic
973698157 4:53511444-53511466 TCTCAGATGGTGATGGGTGATGG + Intronic
973842904 4:54880573-54880595 CCTCACATGGCATAGAGAGATGG + Intergenic
974370358 4:61008989-61009011 CCTCACATGCTGAAGGGATGAGG + Intergenic
975658926 4:76669029-76669051 CATCACATGGAGACGGGATAGGG + Intronic
975713928 4:77187690-77187712 ACTCACATGGTAAAAGGAGCAGG - Intronic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
976397607 4:84572989-84573011 CCTCACATGGTGGAGAGAAAAGG - Intergenic
976523869 4:86063448-86063470 CTTCTCATGTTTAAGGGAGAAGG + Intronic
976542993 4:86299450-86299472 CCTCACCTGATGAAGGAACAAGG - Intronic
977141927 4:93384126-93384148 CCTCACATGGCCAAAGGGGAAGG + Intronic
977378191 4:96236333-96236355 CTTCACATGGTGAAAGCAGGAGG - Intergenic
977823329 4:101501829-101501851 CCTCACATGGTGGAGGGAGAGGG + Intronic
978265497 4:106819580-106819602 CCTCAGTTGGTGGAGGGAGGAGG + Intergenic
978530874 4:109711865-109711887 CCTGACATGATGCAGTGAGAAGG + Exonic
978850491 4:113330397-113330419 CCTCCAATGGTGGAAGGAGAAGG + Exonic
979362854 4:119784630-119784652 CTTCACATGGTGACAGGAGAGGG + Intergenic
979772686 4:124548395-124548417 CCACAAATGGTGAAAGGAAAAGG - Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
979930540 4:126624574-126624596 CCTCACATGGTGGAAGCATAAGG + Intergenic
980057465 4:128092564-128092586 CCTTACAAGGTGAAGGAAAAGGG + Intronic
980185392 4:129454911-129454933 ACACACATGGTAAAGGCAGAAGG - Intergenic
980325997 4:131347014-131347036 CTTCACAGGGGAAAGGGAGATGG + Intergenic
981290669 4:143071340-143071362 CCTCACCTGGTGAGGAGGGATGG + Intergenic
981552973 4:145960417-145960439 CCTCACAAGGTGAAAGGGAAAGG + Intergenic
982101409 4:151971817-151971839 GATCACATGGTGAAAGAAGAAGG - Intergenic
983058047 4:163122775-163122797 CATCACATGGTGAAGGCAGGAGG - Intronic
983074129 4:163304180-163304202 CCCTAGATGGTGAAGGGTGAAGG + Intergenic
983871739 4:172831830-172831852 CTTCACATGGTGGAGAGAGAAGG - Intronic
985409035 4:189664333-189664355 CCTGACACGGAGAAAGGAGAAGG - Intergenic
985758487 5:1733096-1733118 GCTCAGCTGGTTAAGGGAGAGGG - Intergenic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986512988 5:8528517-8528539 CCTCACATGGCCAGCGGAGAAGG + Intergenic
987702679 5:21421978-21422000 TCTCACATGGTGAAGAGAAGAGG + Intergenic
987774691 5:22349076-22349098 CCTCATATGGTGAAGGGACAAGG - Intronic
988990977 5:36670857-36670879 TCTCACAAGGTGAAGGGAAAAGG - Intronic
989398848 5:40987481-40987503 CCTCACATGGTGGACAAAGAGGG + Intergenic
989692888 5:44166607-44166629 CTTCACATGGTGACAGTAGAGGG + Intergenic
990064213 5:51692601-51692623 CCTCACATGATGGAGAGAGAAGG + Intergenic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
990578697 5:57148392-57148414 CTTCACATGGTCAGAGGAGAAGG - Intergenic
990703497 5:58500728-58500750 CCTCACATGGTGCTGGGAGGTGG - Intergenic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
991582813 5:68174465-68174487 CCTCACATGGTGGAAGGGCAAGG + Intergenic
991632388 5:68669332-68669354 CAACACATGGTTAGGGGAGACGG + Intergenic
992128801 5:73670134-73670156 CCACACTGGGGGAAGGGAGATGG - Intronic
992180193 5:74188508-74188530 ACTCACATGGTGAACGTAGGTGG + Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992762011 5:79958846-79958868 CCTCACATGGTGAAGAGCAGAGG - Intergenic
992799718 5:80284869-80284891 CCACTCATGGTGGAGGGTGAAGG + Intergenic
993233787 5:85276049-85276071 CATCACATGGTGAAAAGACAAGG - Intergenic
993284437 5:85973351-85973373 CCTCACATGGGGAGGGGTGGCGG - Intergenic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
994516306 5:100776656-100776678 CCTCACATAGTGAAGAGAGAGGG - Intergenic
994810227 5:104507865-104507887 CCTCACATGGTAGAAGGAGTAGG - Intergenic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
995316666 5:110782389-110782411 CCACACATGGAGAAAGGTGAAGG + Intergenic
995558503 5:113355674-113355696 CCTCACATGGTAAGAAGAGAGGG + Intronic
995606866 5:113866323-113866345 ACTCAGCTGGTGAAGAGAGATGG + Intergenic
996035009 5:118749178-118749200 CCTGACATGGTGAAGAGAGAGGG - Intergenic
996214020 5:120845873-120845895 CCTCACATGGTGGAAGGTAAAGG - Intergenic
996643694 5:125790216-125790238 CCTCACATGGCTGAAGGAGAAGG - Intergenic
998326591 5:141286397-141286419 CCACTCATGGTGAAAGGTGAAGG + Intergenic
998686745 5:144535661-144535683 CCTCACATCCTGCAGGGACATGG + Intergenic
999486506 5:152002330-152002352 TCTCACATGGTGAGGTGTGAAGG + Intergenic
999816139 5:155178244-155178266 CTTCACATGGTGAAAGGGCAAGG - Intergenic
1000565526 5:162842021-162842043 CCTGATAGGGTGCAGGGAGAAGG + Intergenic
1001360693 5:171083323-171083345 CCTTACATGGTGGAAGGAGTGGG - Intronic
1002002553 5:176206265-176206287 TCTCACATGGTGAAAGCAGAAGG + Intergenic
1002224047 5:177705347-177705369 TCTCACATGGTGAAACCAGAAGG - Intergenic
1003193049 6:3890915-3890937 CCTCACATAGTGGAAGAAGAAGG - Intergenic
1003196024 6:3915654-3915676 CCTCACAGGGCCAAGGGAAAGGG - Intergenic
1003436197 6:6090833-6090855 CCTCACAGGGCCAAGGGAAAGGG + Intergenic
1003441779 6:6149562-6149584 CCTCACATGGGGCAGAGAGAGGG - Intronic
1003946213 6:11078263-11078285 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1004870997 6:19903729-19903751 CTTCACATAGGGAAGAGAGAGGG + Intergenic
1005169710 6:22968873-22968895 CCTCACCTGGTGGAAGGTGAAGG + Intergenic
1005527494 6:26665315-26665337 CCACAGATGGTGGAGGGGGATGG - Intergenic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1005932129 6:30491648-30491670 GCTCAGGTGGGGAAGGGAGAAGG + Exonic
1006034408 6:31200312-31200334 CCTCACGTGGTGAAGAGAGTGGG - Intronic
1006278952 6:33030647-33030669 CCAAGCATGGTCAAGGGAGAAGG + Intergenic
1006340719 6:33445115-33445137 CCTCACTTGGTGGAGGCTGAGGG + Intronic
1006404161 6:33834400-33834422 CCCCACATGGCTAAGGGGGAGGG - Intergenic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1006761253 6:36463651-36463673 CCTCACATGATGGAAGGAGAAGG - Intronic
1009947413 6:70355908-70355930 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1011184292 6:84657272-84657294 CCTCACATAGAGAAGAGAGAGGG - Intergenic
1012613888 6:101251616-101251638 CCTTACATGGTTAAAAGAGAAGG - Intergenic
1012868670 6:104647134-104647156 CCTCACATGGTGGAAGGCAAAGG - Intergenic
1012983009 6:105849825-105849847 CCTCACATGTTGAATGCAAAAGG - Intergenic
1014539403 6:122655430-122655452 CCTCACATGAGGAAAAGAGAGGG - Intronic
1014573160 6:123036625-123036647 CCTGAAAAGGTGAAGGGAAAAGG - Intronic
1015169890 6:130240762-130240784 CCTCACATGGTGGAAGGGCAAGG - Intronic
1015175723 6:130306003-130306025 CCTCACATGGTGGAAGGAAAAGG + Intronic
1015480001 6:133698496-133698518 CCTCACATGGCAAGGAGAGAGGG - Intergenic
1015814244 6:137191690-137191712 CCAGAGATGGTGAAGGGGGAAGG + Intergenic
1016663024 6:146602991-146603013 CCTCACATGCTAGAGAGAGAAGG + Intronic
1016873238 6:148839296-148839318 CCTCAGAGGGTTAAAGGAGAGGG - Intronic
1016958976 6:149653528-149653550 TCTCACCTGGTGAAAAGAGAGGG - Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018163380 6:161069811-161069833 GCTCCCATGGAGCAGGGAGAAGG + Intronic
1018530323 6:164756212-164756234 ACTCAGCTGGTGCAGGGAGATGG - Intergenic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1019911006 7:4100575-4100597 CCTCACGTGGTGGAAGGAGAGGG - Intronic
1021560068 7:21960881-21960903 CCTCACATGGTGGGGGGTGGGGG - Intergenic
1021945929 7:25727082-25727104 CCTCACCCAGTGAAGTGAGAAGG - Intergenic
1023025020 7:36042335-36042357 CCTGAGATGGTGAGGGGTGATGG + Intergenic
1023444038 7:40213436-40213458 CCTGACATGATGAAAAGAGAAGG - Intronic
1023636173 7:42213073-42213095 CCCCACATGGTGACGGGATTTGG - Intronic
1024027416 7:45424463-45424485 CATCACATGGTGAGGAGGGAGGG + Intergenic
1024271403 7:47645032-47645054 CCTCTCAGGGTGAAGGCATAAGG + Intergenic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024846377 7:53648202-53648224 CCACCAATGGTGAAAGGAGAAGG + Intergenic
1026115419 7:67491744-67491766 CCTCACATGGCAGAGAGAGAAGG - Intergenic
1026345008 7:69466152-69466174 ACTCATATGGTGAAGGCAGATGG - Intergenic
1026586527 7:71660348-71660370 CCTCACACAGTGGAGGGAGGAGG - Intronic
1028224059 7:88229284-88229306 CCTCATATGATGAAAGGACAAGG - Intergenic
1028906522 7:96160566-96160588 CCTCACATGGAGGAAGGAGTGGG + Intronic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029542372 7:101191566-101191588 CCTCACACGGAGAAGAGAGGAGG - Intergenic
1029972454 7:104802543-104802565 CCTCACATGGTGGAAGGGGAGGG - Intronic
1030063717 7:105643065-105643087 CCTAACCTAGTGAAGGCAGATGG - Exonic
1030433565 7:109485194-109485216 CCTCACATAATGGAGAGAGAGGG - Intergenic
1030618958 7:111769013-111769035 CTTCACATGGTGAAAGGGGCTGG - Intronic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1033169729 7:139072942-139072964 CCTCTCATGGTGAGGAAAGAGGG + Intronic
1033992804 7:147308605-147308627 CCTCAAATTGTGAAAGGGGAAGG - Intronic
1034530566 7:151693750-151693772 CCTCACATGGTGGAAGGAGGAGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1035701125 8:1639855-1639877 CCTTACATGAGGAAGGGAGGGGG - Intronic
1037411354 8:18601640-18601662 CCTCACCTAGTGGAGGCAGAAGG - Intronic
1037945854 8:22988922-22988944 CCTTACATGGTGAGGTAAGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1039144154 8:34426785-34426807 CCTCAAATAGGGAAGAGAGATGG - Intergenic
1040012520 8:42674308-42674330 ACTCACATGGTGACTGGGGAAGG - Intergenic
1040427618 8:47304597-47304619 CTTCACATGGTGAAAGCAGGGGG - Intronic
1040579712 8:48687949-48687971 CCTCAGGTAGTAAAGGGAGAGGG - Intergenic
1040890553 8:52312435-52312457 TCTCACATGGAGAAGAGAGGTGG + Intronic
1042659674 8:71140849-71140871 CCTCACATGATGAAAGGGGTGGG + Intergenic
1045651288 8:104343778-104343800 CCTCACATGGCGGGGAGAGAAGG - Intronic
1046427452 8:114073529-114073551 CCTAACATTGTGAAAGGAGCAGG + Intergenic
1046551776 8:115727374-115727396 CCCCAAATGATGAAGGCAGAAGG + Intronic
1046606330 8:116375445-116375467 CCTCACAATGTCAGGGGAGAAGG + Intergenic
1046692285 8:117299193-117299215 CATCACATAGTGAAAGGAGGAGG - Intergenic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1048922672 8:139245456-139245478 TGTCACATGGTGAAGGCAGGAGG + Intergenic
1049071169 8:140357229-140357251 AGTCACATGGTGAAGGGGCAGGG + Intronic
1049459030 8:142713506-142713528 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1050005803 9:1128989-1129011 CCTCACATGGAGGAAGGAGAAGG - Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050160801 9:2717422-2717444 CCTCACAGGGTCAAGGGAGTGGG + Intergenic
1050339247 9:4619468-4619490 CAGCACATGTGGAAGGGAGAAGG + Intronic
1050425740 9:5510889-5510911 CCTCAAATGGTGTGGAGAGAAGG - Intronic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056497742 9:87176821-87176843 GCTCATATGGTGAAGACAGAAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057126647 9:92621057-92621079 CTTCACATGGTGAAAGGGGCTGG + Intronic
1057512921 9:95695801-95695823 CTTCACATGGTGGCAGGAGAGGG - Intergenic
1057813792 9:98279101-98279123 CCTTACTTGGTGAAGGGGAAAGG + Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1061138460 9:128750408-128750430 CCCCACATGGGGCAGGGAGGAGG + Intronic
1061885520 9:133589417-133589439 GGTCACATGGTGAGGGGTGAGGG + Intergenic
1061912673 9:133733343-133733365 GCTGAAATGGTGAAGGCAGAAGG + Intronic
1203522402 Un_GL000213v1:55858-55880 GCTGAAATGGTGAAGGGTGATGG - Intergenic
1185997865 X:4973111-4973133 CCTCACACGGTGGAAGGACAAGG - Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1188295347 X:28440752-28440774 CCACACATGGTGGAAGGTGAAGG - Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1189025565 X:37390142-37390164 CCTCACATGGCAAAAGGGGATGG + Intronic
1189495543 X:41505163-41505185 CTTTACATTGTCAAGGGAGAAGG - Intergenic
1190308410 X:49100058-49100080 AGTCACATGCTGAAGGGACAGGG - Intronic
1190481380 X:50880472-50880494 CCTCACATGGTGGGAGGTGAGGG + Intergenic
1193164324 X:78264074-78264096 CCCCACCTGGTGAAGAGGGATGG + Intergenic
1194234133 X:91361252-91361274 CCGAAGATGGTGAAGGGGGAAGG + Intergenic
1194263992 X:91733525-91733547 CCCCACCTGGTGAGGAGAGATGG + Intergenic
1194395940 X:93386268-93386290 CCTCACATAGTGGAAGGTGAAGG + Intergenic
1196095543 X:111794722-111794744 CCTCATATGGTGAAGCAAAAGGG + Intronic
1196224700 X:113152090-113152112 TCTCACATGTGGAAGGGAAAAGG - Intergenic
1196263991 X:113619877-113619899 CCTCACATGGCAAAAAGAGAGGG - Intergenic
1196579682 X:117364074-117364096 CCACACATAGAGAAGGGATATGG + Intergenic
1198127682 X:133662404-133662426 CCTCTCATGGAGAACGCAGAGGG - Intronic
1198771510 X:140135685-140135707 CATCACATGGTGAGGGGAATAGG - Intergenic
1199324950 X:146488463-146488485 CTTCACAGGGTGACAGGAGAGGG + Intergenic
1200024663 X:153247249-153247271 CTTCACATGGTGAAGGGCCTGGG - Intergenic
1200983459 Y:9283189-9283211 TCCCACCTGGTGAAGGTAGAAGG - Intergenic
1202126920 Y:21576498-21576520 TCCCACCTGGTGAAGGTAGAAGG + Intergenic