ID: 1188399941

View in Genome Browser
Species Human (GRCh38)
Location X:29731811-29731833
Sequence GCCCTTGCTGTCTTAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188399941 Original CRISPR GCCCTTGCTGTCTTAATGGG TGG (reversed) Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
914448244 1:147768738-147768760 TTCCTTGCAGTGTTAATGGGAGG - Intronic
914937340 1:151993047-151993069 TCCCTTGCTGTCTTAATAAGTGG - Intronic
915245057 1:154550811-154550833 GCAGGTGCTGTGTTAATGGGTGG + Intronic
919500209 1:198329003-198329025 GCCCTATCTGTCTTAAAGGAAGG + Intergenic
921807461 1:219472398-219472420 GCCCTTTCTGACTTACTTGGTGG + Intergenic
923509829 1:234640905-234640927 GCCCCTGCTTTCTTAAAGAGTGG + Intergenic
924611982 1:245580869-245580891 GCCCATGCTGTCATAATGGATGG + Intronic
1065970977 10:30805942-30805964 GCCCCTGCTCTCTTACTGAGGGG - Intergenic
1069679922 10:70277197-70277219 CGCCTTCCTGTCTTACTGGGAGG - Intronic
1071938552 10:90559939-90559961 AGCCTTGATCTCTTAATGGGAGG - Intergenic
1075340656 10:121644733-121644755 GGCCTTGCTGTGCTAATGGTGGG - Intergenic
1076410931 10:130249818-130249840 GCCCTAGCTGTCTTCGTAGGTGG + Intergenic
1076669386 10:132111352-132111374 GACCTTGCTGTGCTCATGGGGGG - Intronic
1079282055 11:19096404-19096426 GGAATTGCTGTCTTAATGTGGGG + Intergenic
1082078996 11:47997304-47997326 GCCCTGGCAGTCTTACTAGGTGG + Intronic
1082997665 11:59266369-59266391 GGCCTTGCTGTCCAAATGGAGGG - Intergenic
1085759574 11:79230399-79230421 GCCCCTGCTCTATTATTGGGTGG + Intronic
1089155819 11:116401561-116401583 CCCCTTGCAGACTTAATGTGAGG + Intergenic
1092065673 12:5588008-5588030 GCACTTCCTGTCTGCATGGGTGG + Intronic
1101009321 12:100432462-100432484 GGTCTTGCTGTCTTAGTGGTGGG - Intergenic
1103170305 12:118812937-118812959 GCCCAAGCTGTCTTTATGTGTGG - Intergenic
1104870099 12:131988882-131988904 CCCCTTGCTGTCTTCATGTAGGG + Intronic
1108927450 13:55770225-55770247 GCCCTAGCTGCCTTCATGGCTGG - Intergenic
1110285281 13:73742974-73742996 GCTCTTCCTGACTTAATGAGAGG - Intronic
1113470176 13:110538746-110538768 GCCCCTGCTGCCTTGCTGGGAGG - Intronic
1113515051 13:110887901-110887923 TTCCTTGCTGCCTTAATGAGAGG - Intronic
1115464440 14:33699474-33699496 GCCCTTTCTGTCTTCAAGGCTGG - Intronic
1125204270 15:37134515-37134537 GCCTTTCCTATCTTAATGGAGGG + Intergenic
1130150548 15:81308360-81308382 GCCCTTGCTGTCCCCAGGGGAGG - Intronic
1131726025 15:95226046-95226068 GCCTCTGCTGACTTCATGGGAGG - Intergenic
1131866609 15:96717853-96717875 GCCCTTGCTGTCTTGCCAGGAGG + Intergenic
1132142263 15:99405737-99405759 CCCCTTGCAGGCTTGATGGGGGG + Intergenic
1133025867 16:2988731-2988753 GCCCTTGCTGTCTTCCGGGCAGG + Intergenic
1133168204 16:3964014-3964036 GCTCTGGCTGTCCTGATGGGTGG + Exonic
1134405548 16:13955609-13955631 GACCTTGCTGTCTAGAAGGGAGG + Intergenic
1139505029 16:67394392-67394414 GCGCTTACTTTCTTAATGGCAGG - Intergenic
1139847734 16:69932611-69932633 GCCCTGGCTGCCTTAAGAGGAGG - Intronic
1140688548 16:77457997-77458019 GACCTTGCTGTCTAAATCAGTGG - Intergenic
1143006467 17:3838466-3838488 GCCCTTGCTTCCCTCATGGGCGG - Intronic
1143240623 17:5440012-5440034 GCCATTGCTGTCTGAAGGTGGGG + Intronic
1144022873 17:11252443-11252465 GCCCTTGCTGTTTCAGTGGGAGG + Intronic
1149604960 17:57918009-57918031 GCCCCTGCTGTCTCACTGAGAGG + Intronic
1151486186 17:74402286-74402308 GGACTGGCTGTCTTAATGAGTGG - Intergenic
1152033456 17:77857603-77857625 CACCTTGGTGTCATAATGGGTGG - Intergenic
1152500660 17:80706619-80706641 AGCCTCGCTGTCTTAATGAGAGG + Intronic
1155153747 18:23141768-23141790 GCTTTTGCTCTCTGAATGGGTGG + Intronic
1157653690 18:49363658-49363680 ACCCTTGATTTCTTGATGGGAGG + Intronic
1158728473 18:59996767-59996789 GCCTTTGCTTTCTAAATAGGAGG - Intergenic
1162489885 19:10985806-10985828 GGCCTTGCTGTCATCAGGGGTGG + Intronic
1167709844 19:51103924-51103946 GACCCTGGTGGCTTAATGGGAGG - Intronic
926084000 2:10009862-10009884 GCCCTTGCTGTCCCAACAGGAGG - Intergenic
929095869 2:38262764-38262786 GCCTTTGCTGTGTTCACGGGAGG - Intergenic
931323049 2:61191150-61191172 ACCCTTGCAGTGTTTATGGGGGG - Exonic
936991527 2:118372020-118372042 GGCCTTTCTGTCTGAATGTGGGG + Intergenic
939764114 2:146224574-146224596 GCCCTGGCTGTGTAAAGGGGCGG - Intergenic
942792644 2:179778333-179778355 GCCCTGGCAGTCGTAGTGGGAGG - Intronic
946074984 2:217066422-217066444 TCCCTTGATGACTTAATGTGTGG - Intergenic
1168757700 20:327553-327575 GGCGTCGCTGCCTTAATGGGAGG + Exonic
1171767296 20:29297330-29297352 CCCCTTGCTGTCTGACTGGCCGG - Intergenic
1171810350 20:29741745-29741767 CCCCTTGCTGTCTGAATGGCCGG - Intergenic
1175594063 20:60216359-60216381 GCCCTTGCTGTTTTAATCAAGGG + Intergenic
1177251924 21:18603519-18603541 GCCTTCTCTGTCTTAGTGGGGGG + Intergenic
1178784075 21:35636115-35636137 GCCCTTACTGGATTACTGGGTGG + Intronic
950497045 3:13340089-13340111 GCCCTGGCTCTCTGAGTGGGAGG - Intronic
956445779 3:69324404-69324426 GCCCTTTCAGTCTTATTGGCTGG - Intronic
959773438 3:110126796-110126818 GCCCATGCTGTCTTAATTTCTGG + Intergenic
960004633 3:112769445-112769467 TCCCTTGCTCTCAGAATGGGGGG + Intronic
961119773 3:124364013-124364035 TCCCTTGCTGTCTTGAAGTGGGG - Intronic
964275540 3:155005076-155005098 GCCCTAGCTGTTTTCATGGCTGG - Intergenic
967949707 3:194831469-194831491 GCACTTGCGGTCTTAATCAGTGG - Intergenic
969907777 4:10413328-10413350 CCTCTTCCTGTCTTAAAGGGTGG + Intergenic
970522483 4:16899537-16899559 GCTTTTCCTGTCTTATTGGGAGG - Intergenic
971766441 4:30838204-30838226 GCCCTTGCTGAATGAATGGCAGG + Intronic
972226393 4:37017613-37017635 GCCCTTACTGTCTAGATGCGAGG - Intergenic
972290470 4:37686229-37686251 GCCGCTGCTGTCTTCGTGGGAGG - Exonic
972575362 4:40346199-40346221 TCCCTCGCTGTCTTCCTGGGAGG + Intronic
975311083 4:72904575-72904597 GCACATGCTGTCTGCATGGGTGG - Intergenic
976767072 4:88608916-88608938 AACCTTGCTGTCTCCATGGGAGG - Intronic
986061749 5:4198281-4198303 GCCCTTGCTTTCATCATAGGGGG + Intergenic
988958503 5:36345115-36345137 GTCCTTGATGTCTTCATGAGTGG - Intergenic
997515542 5:134486664-134486686 GCCCTTGCTGCAGTAATGAGTGG + Intergenic
997705502 5:135948118-135948140 GCCCTTGCTTTCTTATTGCTTGG - Intronic
1004356376 6:14933096-14933118 GCCCTTGCTGGCTTCATCAGGGG - Intergenic
1004407182 6:15344011-15344033 GCCCTGTCTGTCTGAAAGGGTGG - Intronic
1021626359 7:22596657-22596679 GCCATTGCTGTGTAAATAGGAGG - Intronic
1030369842 7:108686423-108686445 GCCCTTGCTGTGTGGATGGTAGG - Intergenic
1031962679 7:128004068-128004090 GCCCTTGATGTATTTGTGGGAGG + Intronic
1032598379 7:133266191-133266213 GCCTTTGCTGTGTAAATGTGTGG + Intronic
1035684808 8:1515340-1515362 GCCCTGTCTGTCTTAAGGGAAGG - Intronic
1036138099 8:6180789-6180811 GCCATTGCTGACTTCATGGAAGG - Intergenic
1044672319 8:94695219-94695241 GCTGTTGCTGGCTTAATGGGAGG + Intronic
1046569617 8:115946919-115946941 TCCCTTTCTGTCTTAAAAGGTGG + Intergenic
1048369012 8:133760880-133760902 GCCCTTGCTGTTTGAATGCGGGG + Intergenic
1059572029 9:115448403-115448425 GTCCTTGCTGTCATAATGCTGGG - Intergenic
1186403357 X:9280113-9280135 CCCCTTGCTGTCTGTAAGGGAGG - Intergenic
1188399941 X:29731811-29731833 GCCCTTGCTGTCTTAATGGGTGG - Intronic
1189859629 X:45259279-45259301 GGCCTTTCTGTCTAAATGTGAGG + Intergenic
1196971157 X:121109994-121110016 GGCCTTGCTGGCTGCATGGGAGG + Intergenic