ID: 1188400089

View in Genome Browser
Species Human (GRCh38)
Location X:29733408-29733430
Sequence GTGTGATTGGTTTAAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188400089_1188400091 -3 Left 1188400089 X:29733408-29733430 CCAGGGGTTTAAACCAATCACAC 0: 1
1: 0
2: 1
3: 6
4: 47
Right 1188400091 X:29733428-29733450 CACAAGTTGATTTACTTAATTGG 0: 1
1: 0
2: 2
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188400089 Original CRISPR GTGTGATTGGTTTAAACCCC TGG (reversed) Intronic
904360638 1:29969436-29969458 TTGTCATTGTTTTAAACACCAGG - Intergenic
909894748 1:81053611-81053633 GTCTAATAGGTTTAAAGCCCAGG - Intergenic
912754058 1:112309691-112309713 CTGTGATTGGCTCACACCCCAGG + Intergenic
913016050 1:114736294-114736316 GTGTGATTGGTTTAGATCTTTGG - Intronic
917538199 1:175889650-175889672 GGGTCATTGGTTTTAATCCCTGG + Intergenic
918423788 1:184387871-184387893 GTGTGGGTGGTTTGACCCCCGGG + Intronic
1084672717 11:70616630-70616652 GTGTGAATGTTTTAACCCTCAGG - Intronic
1085476654 11:76793550-76793572 GTGCTGTTTGTTTAAACCCCAGG + Intronic
1105845235 13:24288236-24288258 GTGGGATTGGATTTAAACCCAGG + Intronic
1107680875 13:42848740-42848762 GTCTGATTTGTTTCCACCCCAGG - Intergenic
1115962915 14:38855742-38855764 GTGTGATTCATTGAAGCCCCTGG - Intergenic
1116874634 14:50098783-50098805 CTGTGTTTGGTTGAAACCCATGG + Intergenic
1122870507 14:104636044-104636066 GTGTCTGTGGTTTAAACCCCCGG - Intergenic
1130416013 15:83695391-83695413 CTGTGATAGATTTAAACTCCGGG + Intronic
1131339766 15:91587008-91587030 GTGTCATTGAATTCAACCCCTGG - Intergenic
1132288515 15:100683269-100683291 GGGTAATTTGTTTAAAGCCCTGG - Intergenic
1133814469 16:9185841-9185863 GTGTGATTCTTTTAAAACCCTGG - Intergenic
1135277183 16:21123461-21123483 GTGAGATTGGCTTCCACCCCTGG + Intronic
1138672946 16:58629978-58630000 GTGTGATTGGTTTAAATCCGCGG - Intergenic
1141493829 16:84393232-84393254 GTGTGATTGGAATCAACCCGGGG + Intronic
1151600917 17:75105466-75105488 GTGTTATTGGTGTCAACCCTGGG + Intronic
1153259730 18:3211917-3211939 GTGTTGTTGATTAAAACCCCTGG - Intronic
1158304401 18:56088809-56088831 ATGGGATTGGTTTAAATCCCTGG + Intergenic
927074386 2:19563127-19563149 GTGTGATTGGCATAAATCTCTGG + Intergenic
927203024 2:20590178-20590200 GTCTGAGTGGTTTGCACCCCCGG + Intronic
934657074 2:96122022-96122044 CTGGGCTTGGTTTACACCCCAGG + Intergenic
936934033 2:117820602-117820624 GAGTGATTGGTTTACACCCTGGG + Intronic
1169320632 20:4630561-4630583 TTGAGATTGGTTTAAAATCCAGG - Intergenic
1171787274 20:29479321-29479343 GTGAGATTGGTTTAAGCATCTGG - Intergenic
1172557748 20:35857186-35857208 TTGTGATTATTTTAAATCCCTGG + Intronic
1177693684 21:24543493-24543515 GTCTGTTTGGTATAAACCCTAGG + Intergenic
1178326868 21:31653690-31653712 GTTTGTGCGGTTTAAACCCCAGG - Intergenic
1184611362 22:45606095-45606117 GAGAGAATGGTTTGAACCCCCGG - Intergenic
949271755 3:2225207-2225229 GTGCAATTGCTTTAAAACCCAGG + Intronic
950296053 3:11832240-11832262 CTGTGATTGGTTGAATCCCATGG - Intronic
963711298 3:148750754-148750776 GTGTGATTGGCCAAATCCCCAGG + Intergenic
967288580 3:187897477-187897499 GTATGACTGATTTAAACCCCTGG - Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
971748667 4:30617984-30618006 GTGTGACTGAATTAAACACCTGG - Intergenic
979550903 4:121989879-121989901 TTCTGATTGGTTGAATCCCCTGG + Intergenic
983993730 4:174155597-174155619 GTTTGTATGGTTTAAGCCCCTGG - Intergenic
987793701 5:22601525-22601547 GTGTGATTAGTTCAACCCCTTGG - Intronic
997619164 5:135273494-135273516 GTGTGTTTGGGTTAAAGTCCTGG + Intronic
1003421004 6:5958649-5958671 GTGTGTTTGTTTTACTCCCCAGG + Intergenic
1003570226 6:7251323-7251345 TTGTGATTTGTTTAAACTCTGGG + Exonic
1012134041 6:95533613-95533635 GTCTGATTGGTCTAAATCACTGG - Intergenic
1022241484 7:28516722-28516744 GGGTGATTGTTTTAAATTCCAGG + Intronic
1031326499 7:120405833-120405855 GTGGTATTGGTTTAGACACCAGG + Intronic
1036531073 8:9587777-9587799 TTGTTATTGTTTTAAACCACTGG + Intronic
1038220707 8:25604528-25604550 TTGTGATTGGATTCAACTCCTGG - Intergenic
1039136521 8:34330111-34330133 GTGTGGTTGGATAAAACACCAGG - Intergenic
1047184587 8:122621051-122621073 ATGTGATTGGTTTTAGCCCAAGG + Intergenic
1059080243 9:111241614-111241636 TTCTGATTGGTTTAAACCCAGGG - Intergenic
1188400089 X:29733408-29733430 GTGTGATTGGTTTAAACCCCTGG - Intronic
1193103865 X:77646129-77646151 GTGTAAATGGATTAAACTCCTGG + Intronic