ID: 1188402322

View in Genome Browser
Species Human (GRCh38)
Location X:29760764-29760786
Sequence TTTTTTAAGACAAGTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188402322_1188402324 -2 Left 1188402322 X:29760764-29760786 CCTGCTACACTTGTCTTAAAAAA 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1188402324 X:29760785-29760807 AAATAGGATTTCATATACCAAGG 0: 1
1: 0
2: 0
3: 42
4: 363
1188402322_1188402326 17 Left 1188402322 X:29760764-29760786 CCTGCTACACTTGTCTTAAAAAA 0: 1
1: 0
2: 1
3: 17
4: 262
Right 1188402326 X:29760804-29760826 AAGGTGTTATGATGATACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188402322 Original CRISPR TTTTTTAAGACAAGTGTAGC AGG (reversed) Intronic
900691635 1:3984086-3984108 ATTTTTAAAAGAGGTGTAGCCGG - Intergenic
904089401 1:27934256-27934278 TTTTTTTAGAGAAGTGTCTCAGG - Intergenic
906481282 1:46200838-46200860 TTCTTTAAGGCAAATGTTGCCGG + Intronic
908720426 1:67119828-67119850 TTTTTCAAGACAAGGGAAGAAGG + Intronic
909151927 1:72017621-72017643 TTTCTTAAGACAGATGTAGTTGG + Intronic
909299537 1:73994567-73994589 ATTTTTATGAGAAGTGTAGGAGG - Intergenic
911980921 1:104564872-104564894 TTGTTGGAGACAAATGTAGCTGG - Intergenic
912270262 1:108200929-108200951 TTTTTTCTGATAAGTGCAGCTGG - Intergenic
912476298 1:109937973-109937995 TTTTTGAAGACCAGTTTTGCTGG - Intergenic
912533450 1:110343067-110343089 CTTTTTCAGAGAGGTGTAGCAGG + Intronic
914174507 1:145263918-145263940 TTTTTAAATACCAGTGTAGGCGG + Intergenic
914770300 1:150678001-150678023 TTTTTAAAGAGAAATGTGGCTGG + Intronic
918607510 1:186446120-186446142 GTTTTCAAAACAAGTGGAGCAGG + Intronic
918751471 1:188276883-188276905 TTTTTTCACTCAATTGTAGCTGG + Intergenic
919141439 1:193577200-193577222 TCTTTTAATACTAGTGTACCTGG - Intergenic
919614927 1:199794913-199794935 TTTTTTAAAGCCAGTGCAGCTGG + Intergenic
923191162 1:231622126-231622148 TTCTTTTGGCCAAGTGTAGCTGG + Intronic
923560950 1:235041344-235041366 TTTTTTGAGACATGAGTTGCTGG - Intergenic
923908125 1:238408749-238408771 TTTATTAACACAAGTGTAACTGG - Intergenic
1063443478 10:6091964-6091986 TTTTTTAAAACATGTGCAACTGG - Intronic
1064329121 10:14377264-14377286 TTTTTGAAGACAGGTGTATTAGG - Intronic
1064670856 10:17712642-17712664 ATTTTTAATACAAATGTAGGGGG + Intronic
1064865950 10:19880228-19880250 TTTTTTAAGAAAAGTATAATAGG - Intronic
1065008033 10:21397439-21397461 TTTTTTAAGGCAGGGGTGGCTGG - Intergenic
1065245987 10:23758289-23758311 TTTTTTAAAACAAATGGTGCTGG - Intronic
1065376923 10:25052608-25052630 TTTTTTAAAAAAAATTTAGCTGG + Intronic
1066619366 10:37327826-37327848 TTTTTTCAGACAAGTGCTGAGGG + Intronic
1068995380 10:63196583-63196605 TTTTTTCAGAGTAGTGTATCAGG - Intronic
1069203076 10:65647109-65647131 TTTATTAAGATATGTCTAGCCGG - Intergenic
1069838406 10:71324080-71324102 TTATTTAAGACTATTGTAGTAGG + Intronic
1071419548 10:85478268-85478290 TTTCTTAAGAAAAGTGTACCGGG - Intergenic
1072567197 10:96626694-96626716 TTTTTAAAGGCAAGTATGGCAGG - Exonic
1074016948 10:109544004-109544026 TTTTTAAAGACAAGGGCAGAAGG + Intergenic
1075900977 10:126042778-126042800 TTAGTTAAGAAAAGTGTCGCAGG + Intronic
1076495817 10:130897153-130897175 TTTTCAAAGGCAAGTGTAGGAGG - Intergenic
1076631348 10:131853882-131853904 TTTTTAAATACAGGTGTAGCAGG + Intergenic
1078002173 11:7505823-7505845 TTTTTTAAGACAGGTGAGACAGG - Intronic
1079416341 11:20239637-20239659 TTTTTTAAGAAAAGTGAAAGGGG - Intergenic
1081338939 11:41903461-41903483 TTTATTAAGTAAAGTGTAGAAGG - Intergenic
1081497867 11:43633776-43633798 TTTTGAAAGACAAATGTGGCTGG + Intronic
1081502947 11:43684679-43684701 TTTTTTAAAACAACTTTAGTGGG + Intronic
1081877897 11:46422867-46422889 TTCTTTAAGACAATGGAAGCTGG + Intronic
1082620614 11:55417156-55417178 TGTTATAACACAATTGTAGCAGG + Intergenic
1082639629 11:55642139-55642161 TTTTTCAAGAAAAGTGAAGTGGG + Intergenic
1085129309 11:74024331-74024353 TATTTTCAGACAATTGAAGCTGG + Intronic
1085142636 11:74161607-74161629 TTTTTTAAGACGTGGGTAGAGGG + Intronic
1085378377 11:76088823-76088845 TTTTTTAAAACAAGGTGAGCAGG - Intronic
1088354053 11:108922963-108922985 TTTTTGATGACAGGTGTAGAAGG + Intronic
1088713023 11:112525225-112525247 TTTTTTTAGGCAAGTGGAGCAGG - Intergenic
1090965366 11:131593308-131593330 TGTTGAAAGACAACTGTAGCAGG - Intronic
1091521735 12:1252235-1252257 TTTTTTAAGAGAACAGAAGCAGG + Intronic
1091575183 12:1727374-1727396 TTTTTAAAGAGAAATGTAGTAGG + Intronic
1092369977 12:7908817-7908839 TTTTTTAAGACTAGTCAGGCCGG + Intergenic
1093061281 12:14608935-14608957 TTTCTTAAGACAAGTGAAAATGG - Intergenic
1093788880 12:23223662-23223684 TGTTTTAAGGCAAGTGTATCAGG + Intergenic
1094450738 12:30580789-30580811 TTTTTTAAGACAATTGTGTTTGG + Intergenic
1095373118 12:41493874-41493896 TTTTTTAATATAAGTGAATCAGG - Intronic
1098859066 12:75687513-75687535 TATTTTAAGAAAAATATAGCTGG + Intergenic
1101887791 12:108682315-108682337 TTTTTTAAAATATGTGTAGCTGG - Intronic
1102743262 12:115226881-115226903 TTTTATAGGACACATGTAGCAGG - Intergenic
1104023110 12:125006844-125006866 TTTTGTGAGAAAAGAGTAGCAGG - Intronic
1105062490 12:133165923-133165945 TTTGTTAAGACATGTTCAGCTGG + Intronic
1105216152 13:18286896-18286918 TTCTTTAAAACAGGGGTAGCAGG + Intergenic
1105471485 13:20698999-20699021 TTTTTTAAAGCTAATGTAGCTGG + Intergenic
1105952531 13:25243744-25243766 TTTTTTGAGACAAGTCTCGCTGG - Intergenic
1108082597 13:46752310-46752332 GTTTGTAAGACAAATGTAGAGGG + Intronic
1108992329 13:56675905-56675927 TTTTTTAAGAGCAGTTTTGCTGG + Intergenic
1109258559 13:60114474-60114496 TGTTGTAACACAAGTGTAACTGG + Intronic
1109489149 13:63072337-63072359 TTTCTTAAGAGAATTGTAACAGG - Intergenic
1110055239 13:70960656-70960678 TTTTTTAACACAAGTTTCTCAGG + Intergenic
1110098074 13:71556817-71556839 TTGTGTAAGAGAAGTGCAGCAGG + Intronic
1110150935 13:72252167-72252189 TATTGTAAGAGAAGTGTAGAGGG - Intergenic
1110700833 13:78546384-78546406 TTTTTTAAGCCAAGAGTAATAGG + Intergenic
1111009199 13:82289939-82289961 TTTTTTATGAAAAGTGTAAAGGG - Intergenic
1111595172 13:90402140-90402162 TTTTTTAAGACAGGTCTACTGGG + Intergenic
1112611866 13:100962991-100963013 TTTTAAAAGACAAGTGTTCCAGG - Intergenic
1112958199 13:105087867-105087889 TTTTGTAAGACACATGAAGCTGG + Intergenic
1114356144 14:21911138-21911160 TTGTTTAGGGCAAGTGAAGCGGG + Intergenic
1115353217 14:32419549-32419571 TTTTTTAAGACAATTGAATCAGG - Intronic
1116008075 14:39318252-39318274 TTTTTTTAAACCAGTGTAGATGG + Intronic
1117332741 14:54729347-54729369 TCTTTTAAGAAAAGGGTAGGAGG + Intronic
1117898474 14:60510481-60510503 TGTTTTGAGACAAGAGTGGCAGG - Intronic
1121344475 14:93125232-93125254 GTTTTTAACCCAAGTGTAGGGGG + Intergenic
1125697744 15:41653068-41653090 CTTTTTAAAACAGGTGTAGCTGG + Intronic
1126606334 15:50480638-50480660 TTTTTTAAGGCAAGTATAGCTGG + Intronic
1127768597 15:62211839-62211861 TTTTATAGTACTAGTGTAGCAGG - Intergenic
1128002607 15:64207413-64207435 GTTTTTAAGAAATGTGTAGGGGG - Intronic
1129893525 15:79087753-79087775 TTTTTGTACACATGTGTAGCCGG + Intronic
1132822303 16:1880601-1880623 TTTTTTAAGAAAAAAGTGGCTGG - Intronic
1135253858 16:20924604-20924626 CTTTTTAAGACAAGTTTGTCTGG - Exonic
1135325490 16:21522876-21522898 TTTTTCAAGACCAGTCTCGCCGG - Intergenic
1135586254 16:23673570-23673592 TTTTTTAAGAGATGAGTAGCTGG - Exonic
1136128150 16:28200236-28200258 TTTTATAAGCCAAATGGAGCTGG - Intronic
1137966913 16:52944008-52944030 TTTATTAAGACTTGTGTTGCAGG - Intergenic
1138254208 16:55538981-55539003 TTTTTTTAGAAAAGTGAAACAGG - Intronic
1138469591 16:57222888-57222910 TTTTTAATGACCAGTGAAGCTGG + Intronic
1140446104 16:75029442-75029464 TTTTTTAAGAAAAGGTCAGCCGG - Intronic
1141049397 16:80746888-80746910 TTTTTAAAGAGAAGAGAAGCTGG - Intronic
1143803129 17:9401805-9401827 TTTTTTAAAACAAGAGTACATGG - Intronic
1146661284 17:34666631-34666653 TGTTTTAAGACAGCTGTAACTGG - Intergenic
1147268369 17:39248644-39248666 GGTTTTAAGACACGTGTGGCCGG + Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1150509295 17:65732472-65732494 TTGTTCAAGGCAAGTGCAGCTGG - Intronic
1151372457 17:73656868-73656890 TTTTAAAAGACTATTGTAGCTGG - Intergenic
1153315432 18:3716830-3716852 TTTTTTAAAACATTTGTGGCTGG + Intronic
1155256919 18:24006421-24006443 TTTTTGAAGACAATTGCAGGAGG - Intronic
1155546490 18:26921289-26921311 TTTCTAAAGACTAGTTTAGCTGG + Intronic
1155824401 18:30421063-30421085 TTTTTTATGACAAATGAAGTTGG + Intergenic
1156091042 18:33469732-33469754 TTTTTAAAGGCAAGTGAAGTTGG - Intergenic
1157043484 18:44066791-44066813 TTTTATTAGATAAGTGTATCAGG + Intergenic
1158486980 18:57876248-57876270 TGTTTTGAAATAAGTGTAGCTGG - Intergenic
1159133555 18:64309345-64309367 TTCTTCCAGACAAGTGTAGCAGG - Intergenic
1159922127 18:74236118-74236140 TTTTCTAAGACAATTTTAGGTGG - Intergenic
1161688784 19:5718705-5718727 TTTTTTAAGGGAAGGGGAGCTGG + Intronic
1163357800 19:16825686-16825708 TTTTTTAAGACGAGTTTCCCAGG - Intergenic
1163707407 19:18823016-18823038 TTTTTTAAAAAATTTGTAGCTGG + Intergenic
1164523633 19:28997807-28997829 GTTTTGGAGACAACTGTAGCAGG + Intergenic
1164909593 19:31995002-31995024 TTTTTTAGGACAAGTCTGGCTGG + Intergenic
1165638894 19:37367414-37367436 TATTTAAAGACCAGTGTGGCTGG + Intronic
1166417501 19:42606899-42606921 CTTTCTAAGACAAGCGTGGCTGG + Intronic
1167376018 19:49112438-49112460 TTTTTAAAAAGAAGTGTGGCTGG - Intergenic
926678610 2:15647531-15647553 TTTTTAAAAACCACTGTAGCCGG - Intergenic
926999678 2:18780824-18780846 TTTTTAAAGACAAACGTAGGGGG + Intergenic
927144196 2:20150798-20150820 TTTTTTAAGTCATGTCTAGATGG + Intergenic
927302654 2:21534184-21534206 TTTGTTAAGTCATGTGTAACAGG + Intergenic
928545671 2:32327298-32327320 TATTTTGAGACAAAGGTAGCAGG - Intergenic
929210380 2:39350468-39350490 TTTTTAAAAGCAAGAGTAGCTGG + Intronic
929334169 2:40720395-40720417 TTTTTCAAGAAAAGTAAAGCAGG + Intergenic
930029730 2:47050858-47050880 GTTTATGAGACAAGTGTACCTGG - Intronic
930753416 2:54953577-54953599 TTTTTTAAGACAAATGTTTAGGG - Intronic
931189742 2:59988604-59988626 TTTTTTAATACAAGTGTGAATGG - Intergenic
932380505 2:71277437-71277459 TTTTTTAGGACCACTGCAGCGGG - Intronic
932963804 2:76446792-76446814 TTTTTTACTGCAAATGTAGCAGG - Intergenic
935164336 2:100556613-100556635 TTTTTTAATACAAGTAAATCAGG + Intergenic
936157188 2:110055670-110055692 TTTTTTTAAACCAGTGCAGCAGG - Intergenic
936166472 2:110124465-110124487 TTATCTAAGATAATTGTAGCAGG + Intronic
936187506 2:110315774-110315796 TTTTTTTAAACCAGTGCAGCAGG + Intergenic
937379026 2:121358918-121358940 TTTTAACAGACAAGTGTAACTGG + Intronic
939155649 2:138522294-138522316 TTTTTTCAGTCAATTGTATCAGG - Intronic
939926298 2:148178159-148178181 TTTTTTATGCTAAGTTTAGCAGG + Intronic
940329324 2:152457381-152457403 TTTTTCAAGATAAGTGAGGCTGG + Intronic
940734565 2:157435587-157435609 TTTTTTAGGAAAATTGCAGCAGG + Intronic
942676925 2:178436306-178436328 GTTTTTCAGACAAATGTAGTAGG - Exonic
942966158 2:181894249-181894271 TTTTTTGAGACAAATGCAGTAGG + Intronic
943080755 2:183256225-183256247 CTTTTTAAGAAAAGTGCAGAAGG - Intergenic
943173385 2:184433501-184433523 TTTTTTAAGAAAAGATTACCTGG - Intergenic
944098975 2:196001540-196001562 TCTTTTAAGATAAGTGTAATAGG + Intronic
944405875 2:199382871-199382893 TTTTTAAAGAACAGTGTAGTTGG - Intronic
945165603 2:206939731-206939753 CTTTTTAAGACCAATGCAGCTGG + Intronic
945666073 2:212744261-212744283 TTTTTTAAAAGAAGTGTATTTGG - Intergenic
945967022 2:216198886-216198908 TTTTTGGAGAGAAGTGTAGAAGG + Intronic
946484011 2:220083487-220083509 TTTTTTAAGAAATGTGTATAAGG - Intergenic
947776641 2:232717148-232717170 TTATTTAACACAACTGGAGCTGG + Intronic
1169874846 20:10285960-10285982 TTCTTTAAGACATTTGTATCAGG - Intronic
1170344915 20:15374717-15374739 TTGTTTAAGTTAAGTGTAACGGG - Intronic
1170916084 20:20627433-20627455 TTTTAAAAGGCAAGTGTAGGAGG + Intronic
1177283521 21:19017510-19017532 TTATTTAAGCCAAGTTTAGGAGG - Intergenic
1177657612 21:24039496-24039518 TTTTGTAAAACAAGGGGAGCAGG + Intergenic
1178269929 21:31180199-31180221 TTTTTTAAAAAAAGTCTACCGGG - Intronic
1178391153 21:32199381-32199403 TTTTTCAACCCAAGTGTAACAGG - Intergenic
1180138632 21:45877426-45877448 TTTTTTAAAAAAAGAGTAACTGG + Intronic
1183559966 22:38564609-38564631 TTTTTTAAGAGACGGGTATCAGG - Intronic
1184432169 22:44447985-44448007 TTTTTTTAAAAAAGTGTGGCTGG - Intergenic
1185209260 22:49559453-49559475 TTGTTTAAAAAAAGTGTGGCAGG + Intronic
949174684 3:1045615-1045637 GTTTTAAAGAGAAATGTAGCTGG + Intergenic
949736361 3:7176526-7176548 TTTTTGCAGATAAATGTAGCAGG - Intronic
950277166 3:11671792-11671814 ATTTTTAAGAGATGTGTGGCTGG - Intronic
951131490 3:19051339-19051361 TTTTTTAAGATAAGATTAGTTGG + Intergenic
951639224 3:24816032-24816054 TTTTATAAGTCAGATGTAGCTGG + Intergenic
951913068 3:27771494-27771516 TTTTTAAAGAAAATTGTGGCTGG + Intergenic
952312531 3:32203066-32203088 TTTAAAATGACAAGTGTAGCTGG + Intergenic
952825741 3:37523160-37523182 TGTTTTTACACAGGTGTAGCTGG - Intronic
955747298 3:62152847-62152869 TATTTTAACACAAGTGTTGGGGG - Intronic
956262413 3:67358652-67358674 TTTTTTAAGAAACATATAGCTGG - Intergenic
956276770 3:67510554-67510576 TTTTTTAAGACAGATGAAGGAGG - Intronic
956598120 3:70991064-70991086 TTTTTTAAGAAAAGTGAAATCGG + Intronic
956603323 3:71046806-71046828 TCTTTTAAGAAAAGTGGAGTGGG - Intronic
957334036 3:78803587-78803609 TTTTTAAAGACCATTGTATCTGG + Intronic
957474208 3:80703057-80703079 TTTTTTGGGACAATTTTAGCAGG + Intergenic
963186430 3:142422870-142422892 TCATTAAAGACAAGTGTAGAAGG + Exonic
963382467 3:144549061-144549083 TTTAACATGACAAGTGTAGCTGG + Intergenic
964591189 3:158363665-158363687 TATTTTAAGATAATTGTAGAAGG - Intronic
964673063 3:159248120-159248142 TTTTTAAAGATAAGTATAGTGGG - Intronic
965284243 3:166796884-166796906 TTTCTTAATACAATTGTATCAGG - Intergenic
966088876 3:176106086-176106108 TTTTTTATGTCATGTGTAGATGG + Intergenic
967306939 3:188068416-188068438 CCTTTTAAGATAACTGTAGCAGG - Intergenic
968423289 4:503306-503328 GTTTTAAAGAGTAGTGTAGCAGG - Intronic
971151392 4:24035743-24035765 TTTATTAAGACAAAGGTAACTGG + Intergenic
971453785 4:26824310-26824332 CTTATTAAGACAACTGCAGCTGG + Intergenic
971632298 4:29009061-29009083 TTTTTTAAAACATGTTTATCAGG + Intergenic
975701505 4:77071245-77071267 TTTTTTAAAACAAAGGTATCTGG + Intronic
976578520 4:86705812-86705834 TTTTTTAAGTCACATGTAGTGGG - Intronic
976788494 4:88850256-88850278 TATTTTAAGAAAATTGTGGCCGG + Intronic
976815663 4:89146255-89146277 TTTTTTAAAAGAACTGTAACAGG - Intergenic
977290494 4:95160196-95160218 TCTTTTGACACAAGTGCAGCTGG - Intergenic
977393139 4:96439033-96439055 TTCTTTAAGACATGTTTAGGAGG - Intergenic
978394498 4:108264098-108264120 TGTTTTAAGCTAAGTGTAACAGG + Intergenic
978425875 4:108581703-108581725 TTTTTTAAGATAACAGTAGCTGG - Intergenic
978849223 4:113312989-113313011 TTTTTTGAGACATGTGTAGGAGG + Intronic
979965500 4:127072210-127072232 TTTTTTAAAAAAAGTTTGGCTGG + Intergenic
980588604 4:134853458-134853480 CTTTTTAAGGAAAGTTTAGCGGG - Intergenic
981252525 4:142621024-142621046 TTTTTTAAATCTAGTGTATCTGG + Intronic
981795068 4:148586252-148586274 TTCTTTAAGACCTGTTTAGCTGG + Intergenic
982757838 4:159245244-159245266 TTTTTCAAGGCAAGTGTATGAGG + Intronic
982912002 4:161154229-161154251 TTTTTTAAGATAAATGAAGCAGG + Intergenic
982965724 4:161904568-161904590 TTTTTTAAGACATATTCAGCAGG + Intronic
983110654 4:163745423-163745445 TTTTTTAAGGCACGTGTAGTAGG + Intronic
983398760 4:167236139-167236161 TTTATTAAGACAATAGTAGGTGG + Intergenic
986294505 5:6426279-6426301 ATTTTTAAGAAAAAAGTAGCAGG - Intergenic
987325177 5:16806042-16806064 TTTTTTTAATCAAGTGTAACTGG + Intronic
988601583 5:32644947-32644969 TATTTTAAGACAACTCTAGAGGG + Intergenic
989153416 5:38321859-38321881 GTTTTTAAGACAAATGTACGTGG - Intronic
989222473 5:38984056-38984078 TTTTTTAAAACAAAAGTACCTGG + Intronic
992850175 5:80798979-80799001 TTTTGTTACACAAGTGTAGTGGG + Intronic
993396939 5:87401307-87401329 TTTTTTAAGAGAAAGGTAGAAGG - Intronic
993643029 5:90428983-90429005 TTTGCTATGAAAAGTGTAGCAGG + Intergenic
993956184 5:94235723-94235745 TTTTTTAAGGCTAATGCAGCTGG + Intronic
994027874 5:95105773-95105795 CTTTTAAAGACAAGTCTTGCTGG - Intronic
994906054 5:105841814-105841836 TTTATTAAGAAAAGTGCAGGAGG - Intergenic
996104546 5:119484044-119484066 TTTTTTAAAAAAAGTCAAGCTGG + Intronic
999029328 5:148273518-148273540 ATTTTTATGACAAAAGTAGCTGG - Intronic
1000799788 5:165711788-165711810 TTTCTTAAGACAAGGTTATCAGG - Intergenic
1001214255 5:169840542-169840564 TTTTTTATGCCCAGTGTAGGTGG + Intronic
1001834068 5:174815724-174815746 TTTTTGAAGAAAAGTTTTGCTGG + Intergenic
1002149906 5:177219666-177219688 TTTGTTAAGACTTGTGTGGCTGG + Intronic
1002478401 5:179483161-179483183 TTTTTTAAGACAGGGCTGGCTGG + Intergenic
1003752182 6:9071226-9071248 TTTTTAAAGACAAGTGAATCTGG - Intergenic
1004845219 6:19634313-19634335 TTTTTTAAGCCAAATCAAGCTGG + Intergenic
1004877575 6:19971093-19971115 TTTTTTAAAACAATTATATCTGG + Intergenic
1007680711 6:43631432-43631454 TGTTATCAGACAAGTGCAGCAGG - Intronic
1009569889 6:65371123-65371145 TTTTTTAAGACAAATGATGGTGG + Intronic
1009792950 6:68427181-68427203 TTTTTTACAACAATGGTAGCAGG + Intergenic
1010364141 6:75030383-75030405 TTTTTTAACACTAATGTAACAGG + Intergenic
1011239819 6:85258941-85258963 TTTTTTAAGACTTGTATATCAGG + Intergenic
1014695783 6:124619706-124619728 TTTTATATGGCAAGTGTAGAAGG - Intronic
1015254925 6:131168113-131168135 TTTATTAAGAAAAATGTGGCTGG + Intronic
1016192839 6:141291994-141292016 TTTTTTCAGAAAAGTGTAAAAGG - Intergenic
1018048636 6:159988213-159988235 TCTTTTAAGAAAAGCATAGCAGG + Intronic
1019233799 6:170591408-170591430 TTTTTGAAGGCTAGTTTAGCTGG - Intergenic
1019877457 7:3826890-3826912 TTTTAGAAGAGGAGTGTAGCTGG + Intronic
1022136387 7:27453389-27453411 TATTTTAAGAGTAGTCTAGCTGG + Intergenic
1022631346 7:32088284-32088306 TTTTTTAATACCAGTTAAGCAGG + Intronic
1028056662 7:86253773-86253795 TTTATTAAGACCAGTTTGGCTGG - Intergenic
1028433859 7:90778954-90778976 TTTTTTAAGACATGGGCAACTGG + Intronic
1031080217 7:117250674-117250696 TTGTTTAACAAAAGTGTTGCAGG - Intergenic
1031411553 7:121445578-121445600 TTTTATAAGACAAAAGTCGCTGG + Intergenic
1031495076 7:122436523-122436545 TTTTTTAAGAAAAAAGTAGGGGG + Intronic
1031680874 7:124673190-124673212 GTTTTTAAGAAAAGGGTAGAAGG - Intergenic
1038755556 8:30337367-30337389 TTTTTTAAGAAAATAGTAACAGG + Intergenic
1042500911 8:69508043-69508065 TTTTTAAAAATAAGGGTAGCAGG - Intronic
1043662751 8:82765731-82765753 GTTTTTAAAACAATTATAGCAGG - Intergenic
1046182307 8:110667093-110667115 TTATTCAAGACAAGAGTTGCCGG + Intergenic
1046938540 8:119908613-119908635 TCTTGTGGGACAAGTGTAGCTGG + Intronic
1049981871 9:911358-911380 TTGTTTAAGCCAAAAGTAGCAGG + Intronic
1050996708 9:12229729-12229751 ATTATTAGGACAGGTGTAGCCGG - Intergenic
1051284948 9:15486533-15486555 TTTTTAAAGAGAAGTGTTGTAGG - Intronic
1052252392 9:26413821-26413843 TATTTTAAGGCAAGGGAAGCTGG + Intergenic
1052646782 9:31246373-31246395 TTTTTTAAGAAAAATGTAAATGG - Intergenic
1054916012 9:70495958-70495980 TCTTTTAAGAAAACAGTAGCTGG - Intergenic
1056343886 9:85670446-85670468 TTAATTAAAGCAAGTGTAGCAGG + Intronic
1056695889 9:88852275-88852297 TTTTTTAAGACAAGTTAAAAAGG - Intergenic
1057775116 9:98001503-98001525 TTTTTAAAGAACAGAGTAGCAGG + Intronic
1058936937 9:109778575-109778597 TTTTTCATAACAAGTGTAGGTGG - Intronic
1059530746 9:115033226-115033248 TTTTCTAAGACATGTAAAGCTGG + Intronic
1060537347 9:124400679-124400701 ATTTTTGAGAAAAGTATAGCAGG - Intronic
1061087492 9:128407755-128407777 TTTTTAAAGGCAACTGCAGCTGG + Intergenic
1061532316 9:131224391-131224413 TTTTTTAAGACAGGTGGTCCAGG + Intronic
1203428694 Un_GL000195v1:67877-67899 TTTTTTAAGACAGGCCTAGTGGG - Intergenic
1203624727 Un_KI270750v1:3503-3525 TTTCTTAAGAGAATTGTAACAGG - Intergenic
1186105967 X:6206204-6206226 TTCTGGAAGACAAGTGTGGCTGG + Intronic
1187475016 X:19602951-19602973 TTTTTTAGCACAAGTTTTGCAGG - Intronic
1188275443 X:28195125-28195147 TTTTTGAAGGAAAGTTTAGCAGG - Intergenic
1188402322 X:29760764-29760786 TTTTTTAAGACAAGTGTAGCAGG - Intronic
1193063427 X:77231431-77231453 TTTTTTATCACAAATGTAGATGG - Intergenic
1193378388 X:80789069-80789091 TTTTTTAAGTCAACTGTATTAGG - Intronic
1195448073 X:104976445-104976467 TTTATTAAGCAAAGTGTAGAAGG + Intronic
1196318051 X:114253073-114253095 TTTTCTCAAAGAAGTGTAGCTGG - Intergenic
1198233484 X:134715352-134715374 GTTTTTAAGAAAAGTAGAGCTGG + Intronic
1198473591 X:136973761-136973783 TTCATAAAGATAAGTGTAGCTGG - Intergenic
1199104591 X:143848975-143848997 TTTTTGATGACAATTTTAGCTGG - Intergenic
1201634065 Y:16102578-16102600 TTTGTTAAAACTATTGTAGCAGG - Intergenic