ID: 1188405791

View in Genome Browser
Species Human (GRCh38)
Location X:29807523-29807545
Sequence AAGAGCCTCTTGAACCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70636
Summary {0: 1, 1: 6, 2: 325, 3: 7528, 4: 62776}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188405786_1188405791 3 Left 1188405786 X:29807497-29807519 CCCAGCTACTTGGAAAGCTGAGG 0: 180
1: 8547
2: 112092
3: 220656
4: 256350
Right 1188405791 X:29807523-29807545 AAGAGCCTCTTGAACCCGGGAGG 0: 1
1: 6
2: 325
3: 7528
4: 62776
1188405785_1188405791 11 Left 1188405785 X:29807489-29807511 CCTGTAATCCCAGCTACTTGGAA 0: 1904
1: 54917
2: 152010
3: 260731
4: 534754
Right 1188405791 X:29807523-29807545 AAGAGCCTCTTGAACCCGGGAGG 0: 1
1: 6
2: 325
3: 7528
4: 62776
1188405783_1188405791 30 Left 1188405783 X:29807470-29807492 CCGGGCATGGTGGCATGCACCTG 0: 1803
1: 8852
2: 28337
3: 66513
4: 125504
Right 1188405791 X:29807523-29807545 AAGAGCCTCTTGAACCCGGGAGG 0: 1
1: 6
2: 325
3: 7528
4: 62776
1188405788_1188405791 2 Left 1188405788 X:29807498-29807520 CCAGCTACTTGGAAAGCTGAGGC 0: 129
1: 6679
2: 98129
3: 207811
4: 243380
Right 1188405791 X:29807523-29807545 AAGAGCCTCTTGAACCCGGGAGG 0: 1
1: 6
2: 325
3: 7528
4: 62776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188405791 Original CRISPR AAGAGCCTCTTGAACCCGGG AGG Intronic
Too many off-targets to display for this crispr