ID: 1188407806

View in Genome Browser
Species Human (GRCh38)
Location X:29833478-29833500
Sequence GAAGTGTTCAGGGACTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188407806_1188407812 -8 Left 1188407806 X:29833478-29833500 CCCAAGGAGTCCCTGAACACTTC No data
Right 1188407812 X:29833493-29833515 AACACTTCTGGGAGAATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188407806 Original CRISPR GAAGTGTTCAGGGACTCCTT GGG (reversed) Intronic