ID: 1188407806

View in Genome Browser
Species Human (GRCh38)
Location X:29833478-29833500
Sequence GAAGTGTTCAGGGACTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188407806_1188407812 -8 Left 1188407806 X:29833478-29833500 CCCAAGGAGTCCCTGAACACTTC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1188407812 X:29833493-29833515 AACACTTCTGGGAGAATTATAGG 0: 1
1: 0
2: 2
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188407806 Original CRISPR GAAGTGTTCAGGGACTCCTT GGG (reversed) Intronic
904806864 1:33138087-33138109 CAAGTGCTCAGGGACTTCTCAGG + Intergenic
905388448 1:37620738-37620760 GAAGTTATGAGGGAGTCCTTTGG + Intronic
909447718 1:75766303-75766325 GAATTATTCAGTGACTCCTCTGG + Intronic
914355543 1:146881406-146881428 GAAGTGTTCATGGAATGCATGGG + Intergenic
914895298 1:151665990-151666012 GAAGTGATCAGTCACTCCTTTGG + Exonic
915703924 1:157825209-157825231 GATGGGTTCAGGGACCCATTGGG + Intergenic
917414746 1:174797275-174797297 GAAGAATTCAGTGACTTCTTAGG - Intronic
917542458 1:175927442-175927464 GTAGTTTTCAGGGACTGCTGTGG - Intergenic
917906732 1:179592292-179592314 GAAGCCTTCAGGGGCTCCTCGGG - Intronic
922326078 1:224529725-224529747 GAACTGATAAGGGACTCCATGGG + Intronic
923477916 1:234354265-234354287 GAAGTTTTCAGGATCTTCTTTGG - Intergenic
923634697 1:235683717-235683739 AAAGTGTTCATGTTCTCCTTTGG - Intronic
924212889 1:241788780-241788802 AGAGTGTTCAAGGACTACTTTGG + Intronic
1062834298 10:625908-625930 GAAATTTCCAGGGACTCCTGTGG - Intronic
1064454381 10:15473111-15473133 GAGTAGTTCAGGGACTCCTCGGG - Intergenic
1066581365 10:36886111-36886133 GAGAAGTACAGGGACTCCTTAGG - Intergenic
1067344182 10:45426041-45426063 GAAGTGTTCTGGGCCTGGTTGGG - Intronic
1067560907 10:47303864-47303886 GAAGTGCTTAGGGAATACTTGGG - Intronic
1071141888 10:82519207-82519229 CAAGTGTTCAGAGAGTTCTTAGG + Intronic
1071712782 10:88066124-88066146 AAAGTGTTTAGGGAGTCCTAGGG + Intergenic
1076857817 10:133126338-133126360 GTAGTTCTCAGGGACTCCCTAGG - Intronic
1079246176 11:18753797-18753819 CAAGTGTTCAGGGACATCTTGGG + Intronic
1079540486 11:21567249-21567271 TAAGTCTTCAGGGAGTCATTTGG + Intronic
1079771150 11:24461405-24461427 GAAGTGTTGAGGAACGTCTTTGG + Intergenic
1080134040 11:28832951-28832973 GAAGGCTTCAGTTACTCCTTAGG - Intergenic
1083938747 11:65883810-65883832 GATGTGTACAGTGGCTCCTTGGG - Intronic
1087182524 11:95153878-95153900 CAAGAGTTCAGTCACTCCTTGGG + Intergenic
1088163593 11:106904457-106904479 GAAGTTTTCATGAACTTCTTTGG + Intronic
1088457934 11:110051839-110051861 GAAATGTTCGTGGACTCCTAAGG - Intergenic
1089862022 11:121598115-121598137 GAAATCTTCAAGGGCTCCTTAGG - Intronic
1090738993 11:129639880-129639902 CATTTGTTCAGGGACTCTTTGGG + Intergenic
1091323262 11:134666308-134666330 GCAGTGTTCAGTGACTGCCTGGG + Intergenic
1098196732 12:68010076-68010098 GAAGTGTTCATGGAGTCCCTTGG - Intergenic
1100242774 12:92726525-92726547 GAATTGTTCAGATATTCCTTTGG - Intronic
1102808988 12:115807581-115807603 GAAGTGTTCACTGATTCCATAGG - Intergenic
1109317395 13:60766373-60766395 GCACAGTTCAGGGATTCCTTAGG + Intergenic
1109396087 13:61761667-61761689 GAATTGTTGAGGCTCTCCTTAGG - Intergenic
1111433305 13:88173190-88173212 GAAGTGCTCAGGGACTCTTGAGG + Intergenic
1113345556 13:109474501-109474523 GAAGTGGCCAGGGATTACTTTGG - Intergenic
1115533504 14:34348802-34348824 GAAGTGTCCTGGGCCTCCTGAGG - Intronic
1116971268 14:51068593-51068615 GAAAGGTTAAGGAACTCCTTAGG + Intronic
1118326892 14:64787219-64787241 GAAGGGGTCAGGGTCTCCTATGG - Intronic
1119498389 14:75101021-75101043 CAAGTGATCAGGGTCTCCTGCGG - Exonic
1120979209 14:90276047-90276069 GATGTGATCAGTGACTCCTTCGG + Exonic
1129603485 15:77013551-77013573 GGAGTGGTCAGGGACTCCAGGGG - Intronic
1133427007 16:5701350-5701372 GTAGAGTTAAGGGACTTCTTGGG + Intergenic
1133707205 16:8366202-8366224 GAAGTGTCAAGAGACTCCATCGG + Intergenic
1133922799 16:10169086-10169108 GAAGTGTTCAGATACTCCATGGG - Intronic
1134774218 16:16837937-16837959 GGAGTGTTCAGGGTCACCTGAGG + Intergenic
1138886397 16:61084690-61084712 AAAGTGTTCAATGACTCCCTTGG - Intergenic
1139674984 16:68517467-68517489 GAATTGTTCAGTGCCTGCTTGGG - Intergenic
1139978476 16:70834037-70834059 GAAGTGTTCATGGAATGCATGGG - Exonic
1140466723 16:75188957-75188979 GAAGTGCTCGCGGACTGCTTAGG + Intergenic
1140533106 16:75683946-75683968 CAAGTGTTAAGGGACTCCCTTGG - Intronic
1141467476 16:84215867-84215889 GATGTGTTTAGGGTCTCCTTGGG + Intergenic
1142103037 16:88285669-88285691 GAGGTGCTCAGGGCCTCCGTGGG + Intergenic
1143634387 17:8156070-8156092 CAAGTGTCCAGGGACTCCACGGG + Intronic
1145269080 17:21394903-21394925 GAAGTGCTGAGGGACCCCTGAGG + Intronic
1148760494 17:49997245-49997267 GAGGCGTTCAGGGCCTGCTTTGG + Intergenic
1153734235 18:8047752-8047774 GAATTGGCCAGGGACTCCTGGGG + Intronic
1163090683 19:15017806-15017828 GAAGCCTTCAGTGACTCTTTGGG - Intronic
1164796820 19:31040231-31040253 GAAGTCCTCAGGGACTCTTCTGG + Intergenic
1166082373 19:40452079-40452101 GGGGTGTTCACGGGCTCCTTGGG - Intronic
1167873176 19:52390333-52390355 GAAGAGTTCACGGCCTCCCTGGG - Intergenic
927440479 2:23112675-23112697 TAAGAGTTCACAGACTCCTTGGG + Intergenic
929294523 2:40232176-40232198 GAAATGTTCAGGGTCTCCTAAGG - Intronic
929411626 2:41703345-41703367 GAATTGTTTAGCGACTCTTTGGG + Intergenic
929440882 2:41965168-41965190 TAAGTGTTCAGGGACTGCACTGG - Intergenic
929593744 2:43162834-43162856 CAAGTCTTCAGGGACTCCAAGGG + Intergenic
930804671 2:55478616-55478638 GAAGCCTCTAGGGACTCCTTTGG + Intergenic
931684147 2:64779147-64779169 GAAGTGTAAAGGCACTCCTGAGG + Intergenic
932261388 2:70330591-70330613 GAAGTCTGCAGGAACTTCTTCGG + Intergenic
932302728 2:70678524-70678546 GAAGTGGTCAGGGGCTCAGTGGG + Intronic
935274402 2:101463660-101463682 GTGGTGTTCAGGGCCCCCTTGGG - Intronic
938756980 2:134389742-134389764 TAAGTGTTAGGTGACTCCTTTGG + Intronic
941181273 2:162262206-162262228 GAAGTCATCAGGGAGACCTTGGG + Intergenic
942765224 2:179447576-179447598 GCTCTGTTCAGTGACTCCTTTGG + Intronic
943715086 2:191142795-191142817 GTAGTGTTCAGGGGCTCCGTGGG + Intronic
944420030 2:199519782-199519804 GAAGTCTTCAGAGAAACCTTAGG + Intergenic
944875310 2:203958739-203958761 AAAGTGTTCAGTGACTCTTTTGG + Intronic
946360211 2:219214908-219214930 GAACTATCCAGGGACTCCCTTGG - Intronic
946659412 2:221983870-221983892 GGAGTGCTTAGGCACTCCTTTGG - Intergenic
947903631 2:233743603-233743625 GACGTCTTCAGGGAGTTCTTCGG - Intronic
947905018 2:233754956-233754978 GAGGTCTTCAGGGAGTTCTTTGG - Intronic
1169515061 20:6307516-6307538 GAAGTGTGCAAGGCCTCTTTAGG + Intergenic
1171866405 20:30489501-30489523 GAGGTGCTCAGGGACGCCTAGGG + Intergenic
1177920499 21:27146330-27146352 GAAGTCTGCAGGGCCTCCATTGG + Intergenic
1181360101 22:22327687-22327709 GAATTGGTCAGGGACCCCTGAGG - Intergenic
1181412654 22:22734962-22734984 GAAGCGATCAGGGACCCCTGAGG - Intronic
1181420281 22:22792876-22792898 GAAGCGATCAGGGACCCCTGAGG - Intronic
1181424331 22:22823162-22823184 GAAGCGATCAGGGACCCCTGAGG - Intronic
1182341037 22:29620906-29620928 GCAGTGATCAAGGACTACTTTGG + Intronic
1184075460 22:42174467-42174489 GCTGTGTTCAGGGACACATTAGG - Intronic
950677329 3:14562293-14562315 GAAGTGTTCAGGGTCTGAGTGGG + Intergenic
952476853 3:33718751-33718773 GAAGTGTCCTGGGACTTCCTGGG - Intergenic
954139444 3:48597284-48597306 GAAATGTTCAGGGAAAGCTTGGG - Intergenic
954537592 3:51373144-51373166 GAATTTCTCAAGGACTCCTTTGG + Intronic
954662705 3:52234586-52234608 GAAGGGTGCAGGATCTCCTTAGG + Intronic
954954628 3:54508344-54508366 GAGGTGTTCAGGGCCTGGTTTGG + Intronic
955472393 3:59299118-59299140 GAAGTGTTCTGGGACTTCAAGGG - Intergenic
955901213 3:63757401-63757423 GAAATGTACAGGGAGTCATTAGG + Intergenic
960474034 3:118102055-118102077 TAAGGATTCAGGGACTCTTTGGG + Intergenic
962000047 3:131286279-131286301 GCAGAGTTCAAGGACTTCTTGGG + Intronic
966336999 3:178879561-178879583 GAAGTGTTCAGGGAACACTTGGG - Intergenic
968765047 4:2463715-2463737 GCAGTGTCCCGGGACTCCGTGGG + Intronic
969628613 4:8322048-8322070 CAACTGTTCTGGGATTCCTTGGG - Intergenic
972674577 4:41247629-41247651 TAAGAGTTCAAGGACACCTTGGG - Intergenic
978650285 4:110996035-110996057 GAGGTGTCCTGGGACTTCTTTGG - Intergenic
983632777 4:169866534-169866556 GGGGAGTTCAGGGACTTCTTGGG + Intergenic
987312583 5:16694837-16694859 TAAGTGAGCAGGAACTCCTTTGG - Intronic
988190342 5:27922439-27922461 GAAGTTTTAAGGAACTCATTCGG - Intergenic
990241255 5:53818667-53818689 GAATTGTTCAGCAATTCCTTAGG + Intergenic
993003123 5:82402841-82402863 GAAGTTTTCCGTGACTCCTCTGG - Intergenic
993535309 5:89077143-89077165 GAAGTGATTAGGGAATCTTTGGG - Intergenic
993620883 5:90166450-90166472 GAAGTGTTCCAGGAGTCTTTGGG - Intergenic
997827371 5:137118510-137118532 GATGTCTTCAAGGACTCCCTTGG - Intronic
999221307 5:149980546-149980568 GAAGTGTTCATTGAGTTCTTTGG - Exonic
1001175371 5:169463668-169463690 GAAGTGGTCTGGAACTTCTTGGG - Intergenic
1003272262 6:4617689-4617711 AAAGATTTCAGGGCCTCCTTAGG + Intergenic
1003328822 6:5112749-5112771 GAAGTCTTCACTGACTCCCTAGG - Intronic
1004783690 6:18941513-18941535 TAAGTATTCAGGGATCCCTTTGG + Intergenic
1007073777 6:39054111-39054133 AAAGTGTTCAGGGAGTGGTTGGG - Intronic
1010295013 6:74185466-74185488 GATGTGTTCAGTGATTGCTTGGG + Intergenic
1012691142 6:102312705-102312727 GATGTGTTCAGGGACTCCCATGG - Intergenic
1015155950 6:130096534-130096556 GCAGTGTCCATGGTCTCCTTAGG + Intronic
1018594041 6:165459324-165459346 GAAGTGTTGAAGGAATCATTAGG - Intronic
1020270847 7:6594678-6594700 GAAGTGTCCAGTGAATGCTTTGG + Intronic
1024270570 7:47638490-47638512 GCAGAGATCAGGGACTCCTAGGG - Intergenic
1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG + Exonic
1024993776 7:55255429-55255451 GAACTGTTCAGGGACTTCTGAGG + Intronic
1028365235 7:90021532-90021554 AAAGTGTTCTGGGACTTATTAGG - Intergenic
1029605012 7:101593423-101593445 GAAGTGTTCCTGGCCTCCTAGGG - Intergenic
1031348285 7:120696410-120696432 GAAGTATTCTGTGACTTCTTAGG + Intronic
1032601437 7:133300414-133300436 GAAGATTTCAGGGACTCTTGCGG - Intronic
1033219071 7:139516039-139516061 GAAATGCTCAAGGACTCATTGGG + Intergenic
1034881479 7:154766112-154766134 GATGTGTTCAAGGACACCTAGGG + Intronic
1041257765 8:55994046-55994068 GAAGAAATCAGAGACTCCTTTGG - Intronic
1043384038 8:79730939-79730961 GAAGTGTTTGGTGGCTCCTTGGG - Intergenic
1046239669 8:111474842-111474864 TATGTGTTCTGAGACTCCTTTGG + Intergenic
1056646211 9:88414107-88414129 GAAGTGTTCATGCCCTCCTGTGG + Intronic
1056730855 9:89165655-89165677 GAAGTGTTCAGTGATGACTTGGG + Intronic
1057457402 9:95227067-95227089 TTAGTGTTCAGGGAGTGCTTTGG - Intronic
1058777618 9:108300460-108300482 GAAGTGCTCAGGGACTCCCTAGG - Intergenic
1060463796 9:123884374-123884396 GAAGTGTTCTGGGAAAACTTGGG - Intronic
1060883722 9:127136182-127136204 AGAGTGTGCAGAGACTCCTTGGG - Intronic
1061111742 9:128577206-128577228 CAAGTGTTCAGGCTCTGCTTCGG + Exonic
1061790429 9:133056148-133056170 GAAGAGTTCAGAGACCGCTTTGG - Intronic
1203625413 Un_KI270750v1:13985-14007 GAAATGTACAGGGACTCTTAAGG - Intergenic
1186235565 X:7504959-7504981 AAAGTGTTCAGAGACTCCCCGGG - Intergenic
1188407806 X:29833478-29833500 GAAGTGTTCAGGGACTCCTTGGG - Intronic
1189680801 X:43513903-43513925 GAAGTGATGAGGGTCTCTTTAGG + Intergenic
1190328200 X:49219493-49219515 GAATTGTTCAGGGATTCCAAGGG + Intronic
1190548785 X:51557742-51557764 GAAGTGTGCAAGGATTCTTTAGG + Intergenic
1190774957 X:53545183-53545205 CAAGTGTTCAGAGACTCCCCTGG + Intronic
1195298936 X:103508299-103508321 GAGGTGCTCAGGGTCTCCTAGGG + Intronic
1195300324 X:103524006-103524028 GAAGTGTTGGGGGTCTCCTTAGG + Intergenic
1195404107 X:104494068-104494090 GAAGGATACAGGGACTTCTTGGG - Intergenic
1195961942 X:110395731-110395753 GGAGATTTCAGGGCCTCCTTAGG - Intronic
1196741806 X:119031754-119031776 GAGGTGTTCAGGGAGGGCTTTGG + Intergenic
1198086587 X:133288172-133288194 GAAGTGTTCAAGCACTGATTGGG + Intergenic
1199854051 X:151745210-151745232 GCAGTTTTCAGGGCCTCTTTAGG - Exonic
1201076845 Y:10195732-10195754 GAGGTGCTCAGGGACGCCTGGGG - Intergenic
1202138970 Y:21700838-21700860 TAAGTGTGCAGGGACTCCCAGGG - Intergenic