ID: 1188411696

View in Genome Browser
Species Human (GRCh38)
Location X:29880684-29880706
Sequence CTGTCAAAAGGGAAGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188411696 Original CRISPR CTGTCAAAAGGGAAGTTTGA TGG (reversed) Intronic
902450808 1:16495870-16495892 CTGGCAAAAGGCAAGTTTGGAGG - Intergenic
902452801 1:16508650-16508672 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
902472861 1:16661321-16661343 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
902485942 1:16746122-16746144 CTGTCAGAACAGAAGTTTCAGGG - Intronic
902502059 1:16917469-16917491 CTGGCAAAAGGCAAGTTTGGAGG + Intronic
904152118 1:28450408-28450430 CTGTCAAATTGGAAATTAGAGGG + Intronic
906474321 1:46157831-46157853 CTTTCAGAAGGGAAGATAGAAGG - Intronic
909024824 1:70469611-70469633 AAGTCCAAAGGGAAGTCTGATGG - Intergenic
909480750 1:76127047-76127069 CTTTTAAAAGGGAAGTTTTGAGG + Intronic
911757910 1:101581949-101581971 TTGTCAAAAGGGGAGTTGGTTGG - Intergenic
913229641 1:116731034-116731056 AAATCAAAAGTGAAGTTTGAAGG - Intergenic
914003083 1:143709140-143709162 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914004858 1:143723554-143723576 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914094289 1:144531626-144531648 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914097214 1:144554176-144554198 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
914301778 1:146383433-146383455 CTGTCAGAACAGAAGTTTCAGGG - Intergenic
914304234 1:146402262-146402284 CTGTCAGAACAGAAGTTTCAGGG - Intergenic
914515491 1:148370672-148370694 CTGTCAGAACAGAAGTTTCAGGG + Intergenic
915498057 1:156295067-156295089 CAGGCAAAAGAGAAGCTTGAGGG + Intronic
916393315 1:164357246-164357268 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
917062234 1:171053336-171053358 CTTTCAAAAGGGATCTGTGATGG + Intronic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
919802997 1:201364741-201364763 CTGTGGGAAGGCAAGTTTGATGG + Intronic
921038054 1:211401495-211401517 TTGTCAGAAGGATAGTTTGAAGG + Intergenic
921230944 1:213069966-213069988 TTGTCATCAGGGAAGTCTGAAGG + Intronic
922118257 1:222635453-222635475 TTGTCAAAAGAGCATTTTGATGG + Intronic
923844421 1:237713031-237713053 CTGTCACAAGGGAAGTAGAATGG + Intronic
1065199923 10:23302706-23302728 CTGTCAAGGAGGAAGTTTAAGGG - Intronic
1067443163 10:46323791-46323813 CTGTCATAAGGCCAGTTTCATGG + Intronic
1068034088 10:51738296-51738318 CCTTCAAAAGGGACGTTTGTAGG + Intronic
1069509821 10:69033803-69033825 ATGAAGAAAGGGAAGTTTGAAGG - Intergenic
1071461379 10:85900068-85900090 GTGTCTTAAGGGATGTTTGAGGG - Intronic
1073187122 10:101622052-101622074 CTATCAAAAGAGAATGTTGAAGG + Intronic
1074115111 10:110451124-110451146 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
1074166479 10:110881468-110881490 CAGTCCAAAGGGAAGGTTGCTGG + Exonic
1079725538 11:23876231-23876253 CTAGCAAAAGTGAACTTTGATGG - Intergenic
1080271509 11:30455356-30455378 CTGTCAAAAGGCCAGTTAGCAGG + Intronic
1080877036 11:36284781-36284803 ATGTCAAATGGGAAGTCTCAGGG + Intronic
1081457345 11:43236993-43237015 CTGTCTTAAGGGAATGTTGAAGG - Intergenic
1081512279 11:43787820-43787842 CTTTAAAAAGGGAACTTTGGGGG - Intronic
1082223834 11:49676917-49676939 TTGGCAAAAGGGAAGTGTGTGGG - Intergenic
1083306809 11:61765770-61765792 CTGTCACCAGGGAGGTCTGAGGG + Intronic
1083349786 11:62019322-62019344 GAGACAAAAGGGAAGTGTGAGGG + Intergenic
1088174715 11:107039313-107039335 CTGTAAAAATGGAAGTCAGAGGG - Intergenic
1088752685 11:112857968-112857990 ATGTCAAGAGGGATGTGTGAGGG + Intergenic
1088898033 11:114092551-114092573 CTCTCCAAAGAGAAGTTTCAGGG + Intronic
1089866454 11:121637224-121637246 CTATCAAAAGGGTTGTTTGGAGG - Intergenic
1089993542 11:122883261-122883283 CTGTCACAAGGGGCGTTTGGAGG - Intronic
1093099595 12:15011639-15011661 TTTTCAAAATGGAAGGTTGAGGG - Intergenic
1093247045 12:16752017-16752039 CTGTCAAGAGGGAAGAGGGATGG + Intergenic
1093278990 12:17167465-17167487 CTGTCAAAAGTGAAACTTAAGGG + Intergenic
1095864648 12:46958068-46958090 CTGTCAAATGAAATGTTTGAAGG - Intergenic
1096064659 12:48730002-48730024 CTGGAAAAAGGGAAATTTGTAGG - Intergenic
1099710175 12:86213751-86213773 CTGTCAAAACCGAAGTTAAAAGG + Intronic
1099861645 12:88230548-88230570 GTGTTAAAAGGGAAGTTTGTTGG - Intergenic
1099894243 12:88624944-88624966 CTCCTAAAAGGGAATTTTGATGG + Intergenic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1101632313 12:106506984-106507006 CTGACAAAAGGCCAGTTTCAAGG - Intronic
1102258234 12:111428475-111428497 CTGTAAAATGGGAAGTGTCATGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102781617 12:115570533-115570555 CTTTCAAAAGGGAAGGGTGGGGG + Intergenic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1104966928 12:132512541-132512563 CTGACAACAGGGACGTCTGAAGG - Intronic
1106544814 13:30721241-30721263 CTGTCAAATGGGTTGTTTGGGGG + Intronic
1107112991 13:36717675-36717697 TTGACAAAAGGGATTTTTGAGGG - Intergenic
1111490139 13:88961594-88961616 CTGTCACATGGGGAGTTTGTTGG - Intergenic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113162691 13:107400375-107400397 CTGCCAAAAAGCAAGGTTGAGGG - Intronic
1113270095 13:108663614-108663636 CTGTCAAGAGGGAATGTAGAGGG - Intronic
1113770615 13:112906004-112906026 CTGAGAACAGGGAAGTTGGACGG - Intronic
1113886382 13:113661249-113661271 GAGTCAAAAAGGAAGTTTCAAGG + Intergenic
1113977654 13:114241748-114241770 CTATCAAAAGTTAAGTTTAAGGG + Intronic
1118735274 14:68696623-68696645 CTGTCTTAAGGGAAGTTTCCTGG - Intronic
1121717369 14:96085875-96085897 TTGTTAAAATGGAATTTTGATGG + Intronic
1125125741 15:36218578-36218600 TTGGCATAAGGGAATTTTGAAGG - Intergenic
1125857021 15:42960367-42960389 CTGTCAAAAGGCAAAGTTGGAGG - Intronic
1125968944 15:43896508-43896530 CTGACACAGGTGAAGTTTGATGG - Intronic
1126558154 15:50013374-50013396 ATGGCAAAAGCAAAGTTTGAAGG - Intronic
1127993457 15:64137398-64137420 CTGTCGAGAGGGAGGTGTGAAGG + Intronic
1129383055 15:75179690-75179712 CTGTCATAGGGGTAGTTTCATGG + Intergenic
1131840555 15:96432230-96432252 CTGTCAAAAGGGAAGAGAGCTGG + Intergenic
1137071362 16:35907524-35907546 GTGTTAAAAGGGGAGTTTGTTGG + Intergenic
1138760864 16:59542622-59542644 CTGTCTAAATGGAATTTTTAGGG + Intergenic
1139178698 16:64720237-64720259 GTGGCAAAAGGGAAGTTTTAAGG + Intergenic
1140772878 16:78222217-78222239 CTGTCTCCTGGGAAGTTTGAGGG + Intronic
1141163426 16:81644469-81644491 CGGCCAAAAGGGCAGTTTGGGGG + Intronic
1141890765 16:86925167-86925189 CTGTTAAAAAGCAGGTTTGAAGG + Intergenic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1148353514 17:46958237-46958259 CTGTAAAATGTGAAGGTTGACGG - Intronic
1148548871 17:48537747-48537769 ATGTCAAAAAAGAAGTTTGGTGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149738281 17:59017283-59017305 CTGTCTGAAGGTAAATTTGAGGG - Exonic
1152911603 17:83008462-83008484 CTGACAGAAGGGAGGTGTGAGGG + Intronic
1155991563 18:32284079-32284101 TTTTCAAAAGGGAACTTTAATGG - Intronic
1156365453 18:36422135-36422157 CGGCCAAGTGGGAAGTTTGAGGG - Intronic
1156396157 18:36701822-36701844 CTGTCCAAAGGGACTTTTGAAGG + Intronic
1156648259 18:39193899-39193921 AAGTAAAAAGGGAAGTTTGGTGG - Intergenic
1156788171 18:40940206-40940228 CTTTAAAAAGGTAGGTTTGAAGG - Intergenic
1160668086 19:342842-342864 CTCTGAAATGGGAAGTTTAATGG - Intronic
1161024362 19:2028761-2028783 CTGTTTAAAGTGAAGTGTGATGG - Intronic
1163939242 19:20477501-20477523 GTGTGAAAAGGGGAGTTTGTTGG + Intergenic
1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166151358 19:40877792-40877814 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1167205261 19:48097205-48097227 CTGTAATAAGGGATGTTTGAAGG - Intronic
925305656 2:2846564-2846586 CTGCCAGAAGGGATGTTTGCTGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
931592150 2:63896331-63896353 TTGTCAAAAGGGAGGTATGGGGG + Intronic
932048078 2:68370209-68370231 ATGTGAAAAGAGAAATTTGAGGG + Intronic
933167983 2:79096071-79096093 GTGTTAAAAGGGGAGTTTGTTGG + Intergenic
936816472 2:116467119-116467141 CAGTAAAAAGGGGAGTTTTAGGG - Intergenic
937875420 2:126821764-126821786 CTGTCTGAATGGAAGTTTGAGGG + Intergenic
939496608 2:142934114-142934136 TTGTTAAAAGGGGAGTTTGTTGG + Intronic
939532448 2:143381580-143381602 CTGTAAAAATGGAAGTGTGCAGG - Intronic
940013512 2:149079780-149079802 CTGTCTAAAGGGAACTCTGGGGG - Intronic
940388748 2:153106130-153106152 CTGTCAAAAGTAATCTTTGAGGG - Intergenic
940477316 2:154179407-154179429 TTGTGAAAAGGGAAATTTGCTGG + Intronic
940570532 2:155427325-155427347 CTTTCTAATGGGAAGTTTTATGG + Intergenic
943498275 2:188652327-188652349 CTGAAAAAAGGGAAGTGTGGAGG - Intergenic
946482844 2:220073570-220073592 TTGTCAAAAGGGAAGATTGTTGG - Intergenic
946775593 2:223136919-223136941 CTGGCAAATCCGAAGTTTGAAGG - Intronic
946934418 2:224705065-224705087 CTGTAAAAAGGGAATCTTAAAGG - Intergenic
947040302 2:225910927-225910949 CAGCCAACACGGAAGTTTGAGGG - Intergenic
947077677 2:226363816-226363838 CTGTCAAAAGGAAAGAAGGAAGG + Intergenic
947898180 2:233694754-233694776 CTGTGAAAAGGCAAGGGTGAGGG + Intronic
1169771148 20:9202235-9202257 CTGTCAAAGGGGCAGCCTGAGGG + Intronic
1172584867 20:36076097-36076119 AAGGCAAAAGGAAAGTTTGATGG - Intergenic
1175080058 20:56411918-56411940 CTGTCATAAGGCAAGTTTTAGGG + Intergenic
1175603758 20:60295979-60296001 ATTTAAAATGGGAAGTTTGAGGG + Intergenic
1180015505 21:45080197-45080219 CTGTTAAAAGGGAAGAGTCATGG + Intronic
1181775850 22:25159662-25159684 CTGTAAAATGGGAAGCTTGGAGG - Intronic
1183126412 22:35785942-35785964 ATGTTAAGAGGCAAGTTTGAAGG - Intronic
1184569962 22:45316403-45316425 CTGTGAAAAAGGAAGTTTGTGGG + Intronic
949487870 3:4557528-4557550 CAGTCAAAAGGGAATTATCATGG - Intronic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
957228896 3:77485929-77485951 CTGTCAAAAGGGCATGGTGAGGG - Intronic
958779630 3:98524645-98524667 CAGGCAAAAGAGAAGTTTAAAGG + Intronic
959538215 3:107511068-107511090 CTGTAAAATGGGAATTTTAACGG - Intergenic
961144519 3:124583239-124583261 CAGAAAAAAGGGAAGTTTGTGGG - Intronic
961748520 3:129081570-129081592 CCGTCCAAATGGAAATTTGAGGG + Intergenic
962326492 3:134438095-134438117 CTGACTAAAAGAAAGTTTGATGG + Intergenic
963046187 3:141104348-141104370 CTGGCAAGAGGGAAGTTTGTGGG + Intronic
964705536 3:159615083-159615105 CTCTCAAAAGAAAAGTTTCAAGG + Intronic
965872351 3:173277604-173277626 GTGTTAAAAGGGGAGTTTGTTGG - Intergenic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
970793936 4:19890390-19890412 GTGTTAAAAGGGGAGTTTGTTGG - Intergenic
971311547 4:25529749-25529771 CTGTCAAATGGGAAGGCTCATGG - Intergenic
971313609 4:25548142-25548164 ATTTCAAAAGGGAAGTATGGAGG + Intergenic
976040080 4:80873523-80873545 ATATCAACAGGGAAGTGTGAAGG - Intronic
976633618 4:87265375-87265397 CTGTTAAAAGTCAAGTTCGAGGG - Intergenic
976662271 4:87552045-87552067 CTGTCAAAAGAATAGCTTGAAGG + Intergenic
977915612 4:102589130-102589152 CTGTAAAATGGGAATTTTAAGGG - Intronic
978213856 4:106173498-106173520 CTGTCACCAGCAAAGTTTGAAGG + Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979835541 4:125362802-125362824 ATGTCAAAAGGGAAGATAGCTGG + Intronic
980800289 4:137739229-137739251 ATCTCACAAGGGAAATTTGATGG + Intergenic
982870361 4:160572414-160572436 CTGCAAATGGGGAAGTTTGAGGG + Intergenic
984311945 4:178072500-178072522 CTCTCAAAAGATAAATTTGATGG + Intergenic
984888341 4:184470914-184470936 CTGTCAGAAGGAAAGTTAGGTGG - Intronic
985116426 4:186596581-186596603 CTGTCAGAAGGGGAGTTTGAAGG + Exonic
987002266 5:13671780-13671802 CTATAAAAAGGGAACTGTGATGG - Intergenic
987159814 5:15130731-15130753 CTCTCATAAGGCAAGTCTGATGG + Intergenic
987976290 5:25019343-25019365 CTGCCAAAACAGAAGTTTCAGGG + Intergenic
988148217 5:27338774-27338796 CTGTAACTTGGGAAGTTTGATGG + Intergenic
988544772 5:32145142-32145164 GTATCAAAAATGAAGTTTGATGG - Intronic
989332560 5:40276942-40276964 CTGTCAAGAGGGCAGTGAGAGGG + Intergenic
990109173 5:52302763-52302785 CTGTCAATGGGGAAGGCTGATGG + Intergenic
990214733 5:53517643-53517665 AAGTCAAAAAGGAACTTTGAGGG + Intergenic
991009204 5:61865148-61865170 ATTTTAAAAGGGCAGTTTGATGG - Intergenic
992139315 5:73780102-73780124 CTGTCAAAAGGAAATTCGGATGG + Intronic
992477221 5:77115501-77115523 CTGATAAGAAGGAAGTTTGAGGG + Intergenic
993085900 5:83363447-83363469 CTTTTGAAAGGGAGGTTTGAAGG + Intergenic
993606287 5:89994296-89994318 CTGTCCACAGGGCAGTTTGGTGG - Intergenic
993956163 5:94235430-94235452 GTGTCAAAAGAAAAGTCTGAAGG + Intronic
994503940 5:100616300-100616322 CTGTCAAAAGAGAATCTAGAAGG - Intergenic
994533831 5:101001897-101001919 ATGTCAAAAGGCAGGGTTGAAGG + Intergenic
995466315 5:112452792-112452814 AGGTCTAAAGGAAAGTTTGATGG - Intergenic
995616058 5:113965508-113965530 CTGCCAAAAGGGAATTCTAACGG - Intergenic
995984607 5:118154446-118154468 CTGTCAAGAAGGATATTTGAAGG - Intergenic
996500048 5:124206468-124206490 CTTTCAAAATTGAAGTTTTATGG - Intergenic
999185872 5:149708254-149708276 CTGTCAAGTGGGATGTTTGAGGG + Intergenic
1002508115 5:179694662-179694684 AAGTCGAAAGGGAAGTTTGATGG + Intronic
1005386848 6:25293728-25293750 CTGTCAAAAGGGAAGAGGAAGGG - Intronic
1007943837 6:45807527-45807549 GTGTTCAAAGGGAAGGTTGAGGG - Intergenic
1008303895 6:49876878-49876900 CTGTCAGAAGGGAAGATAGGGGG + Intronic
1010379342 6:75207429-75207451 CAGTCGAAAGGCAAGTTTGGAGG - Intergenic
1012430097 6:99155046-99155068 CTGTCCAAAGGGAACCTTGCAGG - Intergenic
1012737780 6:102973240-102973262 CTGTCTAATAGGAAGTTTAATGG + Intergenic
1014474725 6:121858274-121858296 AAGTCTAAAGGAAAGTTTGATGG - Intergenic
1014583913 6:123174314-123174336 TTGTCAAAGGGGAAGTTTACGGG + Intergenic
1016152091 6:140753670-140753692 ATGTCAAAAGGGAAGATTACAGG + Intergenic
1020582926 7:10028841-10028863 ATGACAAAAGGGAAGTGTCAAGG + Intergenic
1021330040 7:19325224-19325246 TTGTCAAATGGGAAATTTTAAGG - Intergenic
1022077119 7:26982865-26982887 AAGTCGAAAGGAAAGTTTGATGG - Intronic
1024764093 7:52635670-52635692 CTGTCAAAAAGAAACATTGAAGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1025708864 7:63890182-63890204 TTCTCAAAAGGGAAGTGTGATGG - Intergenic
1025708876 7:63890243-63890265 TTCTCAAAAGGGAAGTGTGATGG - Intergenic
1025708888 7:63890304-63890326 TTCTCAAAAGGGAAGTGTGATGG - Intergenic
1028947660 7:96599144-96599166 CTGTCACAATGGAAGGTTTAGGG + Intronic
1032771629 7:135064837-135064859 TAGTCAAAAGGGAAATTTGTTGG + Intronic
1032978620 7:137254720-137254742 TTTTGAAAAGGGAAGATTGAAGG + Intronic
1033160062 7:138987662-138987684 CTGGCACAAGGGAACTTTAAGGG - Intergenic
1034321973 7:150193651-150193673 ATGTCAAAAAGAAAGTTTCAAGG - Intergenic
1037200762 8:16249720-16249742 GTTTAAAAAGGGAAGTTGGAAGG + Intronic
1037727666 8:21496391-21496413 CTGTGGAAAGGGAAGTGTGCAGG + Intergenic
1039563822 8:38535181-38535203 ATGTCAAAAAGAAAGTTTCAAGG - Intergenic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1039820321 8:41128897-41128919 CTGACAGAAGAGAAGTTTTATGG - Intergenic
1040987778 8:53315177-53315199 CCATCAAAAGGGAAGTTCGCTGG + Intergenic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041638577 8:60172088-60172110 CTGACAATAGGGAAGTATCATGG - Intergenic
1043755156 8:83994152-83994174 CTGTTAAAAGGGATATATGAAGG - Intergenic
1044318453 8:90776006-90776028 TTTTGAAAAGGGAAGTTTCAGGG + Intronic
1044489474 8:92795311-92795333 CTGTCAAAATGGAATCTTGCTGG - Intergenic
1044791787 8:95855156-95855178 CTGTCAAAAGGACAATGTGAAGG + Intergenic
1046561275 8:115840721-115840743 CTTTCAAGAGTGAAGTTTCAGGG - Intergenic
1047002855 8:120590263-120590285 ATGGCAAAAGGGAATTTTGAGGG - Intronic
1047209971 8:122833308-122833330 GTGTTAAAAGGGGAGTTTGTTGG + Intronic
1047220209 8:122912558-122912580 CTGTCTAAAGGGCAGTTTTCTGG - Intronic
1050137462 9:2481803-2481825 CTGGAAAAAGGGAAGGGTGAGGG - Intergenic
1052789847 9:32865103-32865125 CTGCCCAAAGGGAAGCTTGATGG - Intergenic
1057711587 9:97450408-97450430 CTCTCAAAAGGGAACTTTTACGG - Intronic
1060302019 9:122379767-122379789 CCACCAAAAGGGAAGTTAGAGGG - Intronic
1060600891 9:124876613-124876635 ATCTCAAAAGGGAAGCTCGAGGG + Intronic
1062720747 9:138042616-138042638 TTTTCAACAGGGAAGTTTGATGG + Intronic
1186402711 X:9274320-9274342 CTGCCACAAGGGAAGTTTGATGG + Intergenic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1190131920 X:47755865-47755887 CTGTCAAGAGGTAGGTATGAGGG + Intergenic
1191151106 X:57221536-57221558 GTGTTAAAAGGGGAGTTTGTTGG - Intergenic
1191648204 X:63506812-63506834 CTGCCAGAATGGAAGTTTAAGGG - Intergenic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1194899237 X:99487471-99487493 CTGTCAAAATGGAAATTTCAAGG + Intergenic
1195037819 X:100986123-100986145 CTGTACAAAGGTAATTTTGAAGG + Intronic
1198260641 X:134961807-134961829 AAGTCGAAAGGAAAGTTTGATGG - Intergenic
1199343456 X:146709495-146709517 CTGTCACAAGGGCTGTTTGCTGG + Intergenic
1199668626 X:150121804-150121826 CTGTCAGAAGGGAAGGTCTAGGG - Intergenic
1199773179 X:150987792-150987814 AAGTCGAAAGGAAAGTTTGATGG + Exonic
1201723267 Y:17127233-17127255 CAGACAAAAAGGAAGTTAGATGG - Intergenic
1201723510 Y:17130354-17130376 CTGACAAAAGACAAGTTTGCAGG - Intergenic