ID: 1188422185

View in Genome Browser
Species Human (GRCh38)
Location X:30003667-30003689
Sequence GTTTCATTTGAAAATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188422185_1188422189 16 Left 1188422185 X:30003667-30003689 CCTTTAAAATTTTCAAATGAAAC No data
Right 1188422189 X:30003706-30003728 GACTTAAAATAGATAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188422185 Original CRISPR GTTTCATTTGAAAATTTTAA AGG (reversed) Intergenic
No off target data available for this crispr