ID: 1188426364

View in Genome Browser
Species Human (GRCh38)
Location X:30051946-30051968
Sequence GCAATGAAATTGAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188426364_1188426367 0 Left 1188426364 X:30051946-30051968 CCTTCAGGGTTCAATTTCATTGC No data
Right 1188426367 X:30051969-30051991 AGGGAGATTATAGACTGTCAAGG No data
1188426364_1188426371 18 Left 1188426364 X:30051946-30051968 CCTTCAGGGTTCAATTTCATTGC No data
Right 1188426371 X:30051987-30052009 CAAGGAACAGGAAAGGGATGTGG No data
1188426364_1188426368 6 Left 1188426364 X:30051946-30051968 CCTTCAGGGTTCAATTTCATTGC No data
Right 1188426368 X:30051975-30051997 ATTATAGACTGTCAAGGAACAGG No data
1188426364_1188426369 11 Left 1188426364 X:30051946-30051968 CCTTCAGGGTTCAATTTCATTGC No data
Right 1188426369 X:30051980-30052002 AGACTGTCAAGGAACAGGAAAGG No data
1188426364_1188426370 12 Left 1188426364 X:30051946-30051968 CCTTCAGGGTTCAATTTCATTGC No data
Right 1188426370 X:30051981-30052003 GACTGTCAAGGAACAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188426364 Original CRISPR GCAATGAAATTGAACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr