ID: 1188435397

View in Genome Browser
Species Human (GRCh38)
Location X:30152821-30152843
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435397_1188435406 9 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435397_1188435401 -7 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435401 X:30152837-30152859 GGGCCTGCAGGACCTCTTCAAGG No data
1188435397_1188435404 4 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435404 X:30152848-30152870 ACCTCTTCAAGGGAATATGCAGG No data
1188435397_1188435407 21 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435407 X:30152865-30152887 TGCAGGCTTGGACCATGAACAGG No data
1188435397_1188435402 -6 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435402 X:30152838-30152860 GGCCTGCAGGACCTCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435397 Original CRISPR CAGGCCCAGTAATTTTGCTG GGG (reversed) Intergenic
No off target data available for this crispr