ID: 1188435398

View in Genome Browser
Species Human (GRCh38)
Location X:30152822-30152844
Sequence GCAGGCCCAGTAATTTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435398_1188435407 20 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435407 X:30152865-30152887 TGCAGGCTTGGACCATGAACAGG No data
1188435398_1188435406 8 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435398_1188435404 3 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435404 X:30152848-30152870 ACCTCTTCAAGGGAATATGCAGG No data
1188435398_1188435402 -7 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435402 X:30152838-30152860 GGCCTGCAGGACCTCTTCAAGGG No data
1188435398_1188435401 -8 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435401 X:30152837-30152859 GGGCCTGCAGGACCTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435398 Original CRISPR GCAGGCCCAGTAATTTTGCT GGG (reversed) Intergenic