ID: 1188435399

View in Genome Browser
Species Human (GRCh38)
Location X:30152823-30152845
Sequence TGCAGGCCCAGTAATTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435399_1188435407 19 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435407 X:30152865-30152887 TGCAGGCTTGGACCATGAACAGG No data
1188435399_1188435401 -9 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435401 X:30152837-30152859 GGGCCTGCAGGACCTCTTCAAGG No data
1188435399_1188435404 2 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435404 X:30152848-30152870 ACCTCTTCAAGGGAATATGCAGG No data
1188435399_1188435406 7 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435399_1188435402 -8 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435402 X:30152838-30152860 GGCCTGCAGGACCTCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435399 Original CRISPR TGCAGGCCCAGTAATTTTGC TGG (reversed) Intergenic