ID: 1188435403

View in Genome Browser
Species Human (GRCh38)
Location X:30152840-30152862
Sequence TTCCCTTGAAGAGGTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435403_1188435410 15 Left 1188435403 X:30152840-30152862 CCTGCAGGACCTCTTCAAGGGAA No data
Right 1188435410 X:30152878-30152900 CATGAACAGGTCAGCATGATGGG No data
1188435403_1188435406 -10 Left 1188435403 X:30152840-30152862 CCTGCAGGACCTCTTCAAGGGAA No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435403_1188435407 2 Left 1188435403 X:30152840-30152862 CCTGCAGGACCTCTTCAAGGGAA No data
Right 1188435407 X:30152865-30152887 TGCAGGCTTGGACCATGAACAGG No data
1188435403_1188435409 14 Left 1188435403 X:30152840-30152862 CCTGCAGGACCTCTTCAAGGGAA No data
Right 1188435409 X:30152877-30152899 CCATGAACAGGTCAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435403 Original CRISPR TTCCCTTGAAGAGGTCCTGC AGG (reversed) Intergenic
No off target data available for this crispr