ID: 1188435404

View in Genome Browser
Species Human (GRCh38)
Location X:30152848-30152870
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435397_1188435404 4 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435404 X:30152848-30152870 ACCTCTTCAAGGGAATATGCAGG No data
1188435398_1188435404 3 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435404 X:30152848-30152870 ACCTCTTCAAGGGAATATGCAGG No data
1188435399_1188435404 2 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435404 X:30152848-30152870 ACCTCTTCAAGGGAATATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435404 Original CRISPR ACCTCTTCAAGGGAATATGC AGG Intergenic