ID: 1188435405

View in Genome Browser
Species Human (GRCh38)
Location X:30152849-30152871
Sequence GCCTGCATATTCCCTTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435405_1188435407 -7 Left 1188435405 X:30152849-30152871 CCTCTTCAAGGGAATATGCAGGC No data
Right 1188435407 X:30152865-30152887 TGCAGGCTTGGACCATGAACAGG No data
1188435405_1188435410 6 Left 1188435405 X:30152849-30152871 CCTCTTCAAGGGAATATGCAGGC No data
Right 1188435410 X:30152878-30152900 CATGAACAGGTCAGCATGATGGG No data
1188435405_1188435409 5 Left 1188435405 X:30152849-30152871 CCTCTTCAAGGGAATATGCAGGC No data
Right 1188435409 X:30152877-30152899 CCATGAACAGGTCAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435405 Original CRISPR GCCTGCATATTCCCTTGAAG AGG (reversed) Intergenic