ID: 1188435406

View in Genome Browser
Species Human (GRCh38)
Location X:30152853-30152875
Sequence TTCAAGGGAATATGCAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435398_1188435406 8 Left 1188435398 X:30152822-30152844 CCCAGCAAAATTACTGGGCCTGC No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435399_1188435406 7 Left 1188435399 X:30152823-30152845 CCAGCAAAATTACTGGGCCTGCA No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435397_1188435406 9 Left 1188435397 X:30152821-30152843 CCCCAGCAAAATTACTGGGCCTG No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data
1188435403_1188435406 -10 Left 1188435403 X:30152840-30152862 CCTGCAGGACCTCTTCAAGGGAA No data
Right 1188435406 X:30152853-30152875 TTCAAGGGAATATGCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435406 Original CRISPR TTCAAGGGAATATGCAGGCT TGG Intergenic
No off target data available for this crispr