ID: 1188435409

View in Genome Browser
Species Human (GRCh38)
Location X:30152877-30152899
Sequence CCATGAACAGGTCAGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188435405_1188435409 5 Left 1188435405 X:30152849-30152871 CCTCTTCAAGGGAATATGCAGGC No data
Right 1188435409 X:30152877-30152899 CCATGAACAGGTCAGCATGATGG No data
1188435403_1188435409 14 Left 1188435403 X:30152840-30152862 CCTGCAGGACCTCTTCAAGGGAA No data
Right 1188435409 X:30152877-30152899 CCATGAACAGGTCAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188435409 Original CRISPR CCATGAACAGGTCAGCATGA TGG Intergenic
No off target data available for this crispr