ID: 1188440073

View in Genome Browser
Species Human (GRCh38)
Location X:30207991-30208013
Sequence TGCACTGGAAAACTCCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188440073_1188440079 0 Left 1188440073 X:30207991-30208013 CCCTTTTGGAGTTTTCCAGTGCA No data
Right 1188440079 X:30208014-30208036 TATTGGCATATTGAGGGTCCTGG No data
1188440073_1188440077 -7 Left 1188440073 X:30207991-30208013 CCCTTTTGGAGTTTTCCAGTGCA No data
Right 1188440077 X:30208007-30208029 CAGTGCATATTGGCATATTGAGG No data
1188440073_1188440080 1 Left 1188440073 X:30207991-30208013 CCCTTTTGGAGTTTTCCAGTGCA No data
Right 1188440080 X:30208015-30208037 ATTGGCATATTGAGGGTCCTGGG No data
1188440073_1188440078 -6 Left 1188440073 X:30207991-30208013 CCCTTTTGGAGTTTTCCAGTGCA No data
Right 1188440078 X:30208008-30208030 AGTGCATATTGGCATATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188440073 Original CRISPR TGCACTGGAAAACTCCAAAA GGG (reversed) Intergenic
No off target data available for this crispr