ID: 1188441791

View in Genome Browser
Species Human (GRCh38)
Location X:30220820-30220842
Sequence TCCACCAGTACTACGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188441787_1188441791 27 Left 1188441787 X:30220770-30220792 CCTGATGTCTCAGTTGACGAGAC No data
Right 1188441791 X:30220820-30220842 TCCACCAGTACTACGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188441791 Original CRISPR TCCACCAGTACTACGAGATG GGG Intergenic
No off target data available for this crispr