ID: 1188442137

View in Genome Browser
Species Human (GRCh38)
Location X:30223207-30223229
Sequence TCTGAGGGCTGACAGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442137_1188442144 2 Left 1188442137 X:30223207-30223229 CCTCCCTACTGTCAGCCCTCAGA No data
Right 1188442144 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
1188442137_1188442149 29 Left 1188442137 X:30223207-30223229 CCTCCCTACTGTCAGCCCTCAGA No data
Right 1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG No data
1188442137_1188442142 -1 Left 1188442137 X:30223207-30223229 CCTCCCTACTGTCAGCCCTCAGA No data
Right 1188442142 X:30223229-30223251 AGACCCCAAGCAGAAATGTCAGG No data
1188442137_1188442147 16 Left 1188442137 X:30223207-30223229 CCTCCCTACTGTCAGCCCTCAGA No data
Right 1188442147 X:30223246-30223268 GTCAGGTGGAGTTTCCCATCAGG No data
1188442137_1188442148 28 Left 1188442137 X:30223207-30223229 CCTCCCTACTGTCAGCCCTCAGA No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442137 Original CRISPR TCTGAGGGCTGACAGTAGGG AGG (reversed) Intergenic
No off target data available for this crispr