ID: 1188442138

View in Genome Browser
Species Human (GRCh38)
Location X:30223210-30223232
Sequence GTCTCTGAGGGCTGACAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442138_1188442144 -1 Left 1188442138 X:30223210-30223232 CCCTACTGTCAGCCCTCAGAGAC No data
Right 1188442144 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
1188442138_1188442147 13 Left 1188442138 X:30223210-30223232 CCCTACTGTCAGCCCTCAGAGAC No data
Right 1188442147 X:30223246-30223268 GTCAGGTGGAGTTTCCCATCAGG No data
1188442138_1188442149 26 Left 1188442138 X:30223210-30223232 CCCTACTGTCAGCCCTCAGAGAC No data
Right 1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG No data
1188442138_1188442142 -4 Left 1188442138 X:30223210-30223232 CCCTACTGTCAGCCCTCAGAGAC No data
Right 1188442142 X:30223229-30223251 AGACCCCAAGCAGAAATGTCAGG No data
1188442138_1188442148 25 Left 1188442138 X:30223210-30223232 CCCTACTGTCAGCCCTCAGAGAC No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442138 Original CRISPR GTCTCTGAGGGCTGACAGTA GGG (reversed) Intergenic
No off target data available for this crispr