ID: 1188442140

View in Genome Browser
Species Human (GRCh38)
Location X:30223222-30223244
Sequence TTTCTGCTTGGGGTCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442140_1188442149 14 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG No data
1188442140_1188442148 13 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442140_1188442152 22 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442140_1188442147 1 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442147 X:30223246-30223268 GTCAGGTGGAGTTTCCCATCAGG No data
1188442140_1188442153 23 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442153 X:30223268-30223290 GTCCTACTCAAGGGTAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442140 Original CRISPR TTTCTGCTTGGGGTCTCTGA GGG (reversed) Intergenic
No off target data available for this crispr