ID: 1188442141

View in Genome Browser
Species Human (GRCh38)
Location X:30223223-30223245
Sequence ATTTCTGCTTGGGGTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442141_1188442148 12 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442141_1188442152 21 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442141_1188442153 22 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442153 X:30223268-30223290 GTCCTACTCAAGGGTAACAAGGG No data
1188442141_1188442147 0 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442147 X:30223246-30223268 GTCAGGTGGAGTTTCCCATCAGG No data
1188442141_1188442149 13 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG No data
1188442141_1188442155 30 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442155 X:30223276-30223298 CAAGGGTAACAAGGGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442141 Original CRISPR ATTTCTGCTTGGGGTCTCTG AGG (reversed) Intergenic