ID: 1188442143

View in Genome Browser
Species Human (GRCh38)
Location X:30223232-30223254
Sequence CCACCTGACATTTCTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442143_1188442156 22 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442156 X:30223277-30223299 AAGGGTAACAAGGGAAGTGAGGG No data
1188442143_1188442153 13 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442153 X:30223268-30223290 GTCCTACTCAAGGGTAACAAGGG No data
1188442143_1188442148 3 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442143_1188442147 -9 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442147 X:30223246-30223268 GTCAGGTGGAGTTTCCCATCAGG No data
1188442143_1188442152 12 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442143_1188442155 21 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442155 X:30223276-30223298 CAAGGGTAACAAGGGAAGTGAGG No data
1188442143_1188442149 4 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442143 Original CRISPR CCACCTGACATTTCTGCTTG GGG (reversed) Intergenic
No off target data available for this crispr