ID: 1188442146

View in Genome Browser
Species Human (GRCh38)
Location X:30223234-30223256
Sequence CTCCACCTGACATTTCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442146_1188442156 20 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442156 X:30223277-30223299 AAGGGTAACAAGGGAAGTGAGGG No data
1188442146_1188442155 19 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442155 X:30223276-30223298 CAAGGGTAACAAGGGAAGTGAGG No data
1188442146_1188442148 1 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442146_1188442149 2 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442149 X:30223259-30223281 TCCCATCAGGTCCTACTCAAGGG No data
1188442146_1188442152 10 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442146_1188442153 11 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442153 X:30223268-30223290 GTCCTACTCAAGGGTAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442146 Original CRISPR CTCCACCTGACATTTCTGCT TGG (reversed) Intergenic