ID: 1188442148

View in Genome Browser
Species Human (GRCh38)
Location X:30223258-30223280
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442138_1188442148 25 Left 1188442138 X:30223210-30223232 CCCTACTGTCAGCCCTCAGAGAC No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442139_1188442148 24 Left 1188442139 X:30223211-30223233 CCTACTGTCAGCCCTCAGAGACC No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442140_1188442148 13 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442145_1188442148 2 Left 1188442145 X:30223233-30223255 CCCAAGCAGAAATGTCAGGTGGA No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442143_1188442148 3 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442146_1188442148 1 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442137_1188442148 28 Left 1188442137 X:30223207-30223229 CCTCCCTACTGTCAGCCCTCAGA No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data
1188442141_1188442148 12 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442148 X:30223258-30223280 TTCCCATCAGGTCCTACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442148 Original CRISPR TTCCCATCAGGTCCTACTCA AGG Intergenic
No off target data available for this crispr