ID: 1188442152

View in Genome Browser
Species Human (GRCh38)
Location X:30223267-30223289
Sequence GGTCCTACTCAAGGGTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442140_1188442152 22 Left 1188442140 X:30223222-30223244 CCCTCAGAGACCCCAAGCAGAAA No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442143_1188442152 12 Left 1188442143 X:30223232-30223254 CCCCAAGCAGAAATGTCAGGTGG No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442141_1188442152 21 Left 1188442141 X:30223223-30223245 CCTCAGAGACCCCAAGCAGAAAT No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442146_1188442152 10 Left 1188442146 X:30223234-30223256 CCAAGCAGAAATGTCAGGTGGAG No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data
1188442145_1188442152 11 Left 1188442145 X:30223233-30223255 CCCAAGCAGAAATGTCAGGTGGA No data
Right 1188442152 X:30223267-30223289 GGTCCTACTCAAGGGTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442152 Original CRISPR GGTCCTACTCAAGGGTAACA AGG Intergenic