ID: 1188442236

View in Genome Browser
Species Human (GRCh38)
Location X:30223814-30223836
Sequence GGTAATGTATGGAAAGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188442236_1188442240 4 Left 1188442236 X:30223814-30223836 CCAAGTGCTTTCCATACATTACC No data
Right 1188442240 X:30223841-30223863 TCCTGCCAGTTCTGCCAGACAGG No data
1188442236_1188442242 5 Left 1188442236 X:30223814-30223836 CCAAGTGCTTTCCATACATTACC No data
Right 1188442242 X:30223842-30223864 CCTGCCAGTTCTGCCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188442236 Original CRISPR GGTAATGTATGGAAAGCACT TGG (reversed) Intergenic
No off target data available for this crispr