ID: 1188443791

View in Genome Browser
Species Human (GRCh38)
Location X:30235981-30236003
Sequence GGGTCAGACCCAGGATCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188443782_1188443791 30 Left 1188443782 X:30235928-30235950 CCTCGGGGTCAGAAGAGTACGCT 0: 1
1: 3
2: 4
3: 4
4: 20
Right 1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG 0: 1
1: 0
2: 3
3: 10
4: 186
1188443783_1188443791 7 Left 1188443783 X:30235951-30235973 CCATGCACGTGAGAAACGCCAGC 0: 1
1: 1
2: 1
3: 6
4: 56
Right 1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG 0: 1
1: 0
2: 3
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188443791 Original CRISPR GGGTCAGACCCAGGATCACC AGG Exonic
901236557 1:7670398-7670420 AGGAGAGACCCAGGATCCCCAGG - Intronic
901450636 1:9334675-9334697 GGGTCAGTGCCAGGAGCTCCGGG - Intronic
901551110 1:9997071-9997093 TGGGCAGAGCCAGGAGCACCGGG + Intergenic
902409514 1:16204940-16204962 GGGTCAGGCCCAGGGGCACCAGG + Intronic
902659679 1:17892379-17892401 GGGCCAGCTCCAGGAGCACCTGG + Intergenic
903043794 1:20551688-20551710 GGGGCAGCCCCTGGGTCACCAGG + Intergenic
903260079 1:22126902-22126924 GGGTGAGGCCGAGGATGACCTGG - Intronic
903488638 1:23710486-23710508 GGATCAGCCTCAGCATCACCTGG - Intergenic
906143291 1:43546088-43546110 GGGTCAGCCCACGGGTCACCAGG + Intronic
906261062 1:44390610-44390632 GGATTAGACCCAGGATCCACTGG + Intergenic
908401163 1:63774158-63774180 GGGTCAGTCCCAGGCTGTCCGGG - Exonic
913513311 1:119581938-119581960 TGGGCACACACAGGATCACCCGG + Intergenic
913516939 1:119612923-119612945 TGGGCACACACAGGATCACCCGG + Intergenic
914820864 1:151101698-151101720 GGTCCAGCCCCAGCATCACCAGG + Intronic
915530059 1:156498208-156498230 GGGGCAGAGCCAGGATGCCCAGG + Intronic
917356415 1:174131122-174131144 GGGACAGAACCCGGATCTCCTGG - Intergenic
920691408 1:208149636-208149658 GGGTCAGCCTCAGCAGCACCAGG - Intronic
920916015 1:210258614-210258636 GGGGCAGAGCCAAGATCAGCAGG + Intergenic
922765088 1:228152398-228152420 TGTTCAGACCCAGGATGAGCAGG + Intronic
923262955 1:232284774-232284796 AAGTCAGACCCAGGTGCACCAGG - Intergenic
1062794391 10:332811-332833 GGGTATGACCCAGGACCCCCAGG - Intronic
1062829651 10:597191-597213 AGCTGAGACCCAGGAGCACCGGG - Intronic
1064308100 10:14186735-14186757 CGCTCAGCCCCAGGATCCCCAGG + Intronic
1064676921 10:17769690-17769712 TGGCCAGACCCAGTATAACCTGG - Intronic
1069211075 10:65760691-65760713 GGGCCAGGCCCAGGGTCCCCAGG - Intergenic
1070672272 10:78386395-78386417 GTGTCAAAGCCAGGAGCACCCGG + Intergenic
1071458455 10:85869147-85869169 GGACCAGATCCAGGATCTCCGGG + Exonic
1071881013 10:89898215-89898237 GGGACAGACTCAGGACCTCCTGG + Intergenic
1073244619 10:102080930-102080952 GGGTCAGACTCAGGATGCCAGGG + Intergenic
1075616044 10:123891602-123891624 GGGTCACTGCCAGGAGCACCAGG + Exonic
1077095261 11:796393-796415 GGGTCTGACTCAGGCTGACCTGG + Intronic
1077106472 11:844558-844580 GGGCCAGGCCCAGGCTCCCCAGG - Exonic
1077169566 11:1160191-1160213 GGGTCGGCCCCAAGACCACCTGG - Intronic
1079006178 11:16793021-16793043 GGGTGAGCATCAGGATCACCAGG - Intronic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1081873934 11:46396318-46396340 GGGCCAGGCCCAGGTTCTCCCGG - Intergenic
1083596876 11:63921815-63921837 AGGTCAGACCCAGGAGCTCAAGG - Intergenic
1084958884 11:72705902-72705924 GGGCCAGACCCAGAATCACCTGG + Intronic
1085695681 11:78702550-78702572 GCGTCAGCCCCCTGATCACCGGG + Intronic
1089202339 11:116731951-116731973 GGGTCGGCCCCAGGATGCCCTGG - Intergenic
1090360188 11:126166724-126166746 GGGACAGTCCCAGGATGACTGGG + Intergenic
1091789433 12:3263294-3263316 GAGTGACACCCAGGATGACCTGG + Intronic
1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG + Intergenic
1096554137 12:52393108-52393130 GGGTCAGAGACAGGATCACAGGG - Intergenic
1096555050 12:52398674-52398696 GGGTCACAGACAGGTTCACCAGG + Intronic
1097618831 12:61915409-61915431 GGCTCAGAACCAGGATCTACTGG - Intronic
1098600288 12:72323543-72323565 GGGGTAGAGTCAGGATCACCTGG - Intronic
1104760469 12:131295071-131295093 GGGACGGGCCCAGGATCAGCGGG + Intergenic
1104819309 12:131665714-131665736 GGGACGGGCCCAGGATCAGCGGG - Intergenic
1107442998 13:40445325-40445347 GGGTCACACCCAGGGACACTGGG - Intergenic
1108028416 13:46203036-46203058 GGGTCAGCACCAGGTTCACAGGG - Intronic
1116849602 14:49894141-49894163 GGGTCAGGCCCAGTTTCTCCTGG - Exonic
1116869751 14:50059954-50059976 GGGTCAGACCCATGCACTCCAGG + Intergenic
1119676491 14:76559554-76559576 GGGTCCAATCCAGGATAACCTGG - Intergenic
1123934145 15:25186060-25186082 GGGTCAGCCCTCGGGTCACCTGG + Intergenic
1125933348 15:43615624-43615646 GGGCCCGACCCAGCATCCCCTGG + Exonic
1125946446 15:43715086-43715108 GGGCCCGACCCAGCATCCCCTGG + Intergenic
1127729733 15:61788732-61788754 GGGTCAGACCTAGGCTCACATGG + Intergenic
1129884058 15:79026443-79026465 GGGACAAACGCAGGAACACCAGG - Intronic
1131598212 15:93821070-93821092 AGGTGAGACCCGGGAACACCAGG - Intergenic
1132674889 16:1117454-1117476 GGCTCAGAGTCAGGAACACCAGG - Intergenic
1133850721 16:9500837-9500859 AGATCAGACCCAGGTTCATCAGG + Intergenic
1134003750 16:10803624-10803646 GGGTCAGAACCCCGAACACCAGG - Intronic
1136247458 16:28984171-28984193 GGGTCAGAGCCAGGGTGAGCTGG - Intronic
1136567524 16:31079213-31079235 TGGTCAGACCTACGATGACCTGG + Exonic
1137627177 16:49916575-49916597 GTGACAGACCCAGGGTCCCCAGG + Intergenic
1137691295 16:50429956-50429978 GGCTTAGACCCACCATCACCAGG + Intergenic
1138710937 16:58969823-58969845 GTCTCAGACCCAGAAACACCGGG - Intergenic
1138724336 16:59119599-59119621 GGGGCAGCCCCAGGATCAATGGG - Intergenic
1139259404 16:65577504-65577526 GGGTCAGGCCCAGCTTCCCCAGG + Intergenic
1141594850 16:85090995-85091017 GGGGCACACCCAGGGCCACCTGG + Exonic
1142233599 16:88911129-88911151 GGGTCAGGCCCATGAGGACCTGG - Intronic
1142809347 17:2387878-2387900 GGGCCAGCCCGAGGATGACCAGG - Exonic
1144337018 17:14280716-14280738 GGGTGAGGCCCAAGATCAACAGG - Intergenic
1146019062 17:29259936-29259958 GTGTGAGAACCAGGACCACCTGG - Exonic
1146910902 17:36647828-36647850 GGGTCAGTCCCAGGCCCACGTGG + Intergenic
1147654635 17:42081878-42081900 GGGTGAGGCCCAGCATCAACAGG + Intergenic
1150064874 17:62100587-62100609 GGGTTAGGGCCAGGATCACCTGG + Intergenic
1152129373 17:78466798-78466820 GGGAGAAACACAGGATCACCTGG + Exonic
1155911215 18:31506168-31506190 GAATCAAACCCAGGTTCACCTGG + Intronic
1157501625 18:48194650-48194672 GGGACAGGCCCAGCATCACCAGG + Intronic
1157536153 18:48459143-48459165 GTGTCAGACACAGGATAACATGG - Intergenic
1160529122 18:79553322-79553344 GGGTCAGCCCCAGGAGAACCAGG - Intergenic
1160985669 19:1837463-1837485 GGGGCAGAAACAGGGTCACCTGG + Intronic
1161069376 19:2252716-2252738 AGGTCAGACCCAAGATTCCCGGG - Exonic
1161153331 19:2720762-2720784 GGGTCTGACCCAGGGCCGCCTGG + Intronic
1162562357 19:11424044-11424066 AGGTCAGAGCCAGGGTCAGCTGG + Intronic
1162835919 19:13317891-13317913 GGGTCAGACCCCGGAAGTCCAGG - Intronic
1164178828 19:22802084-22802106 GGGTCAGAACCAGGAAGATCAGG + Intergenic
1165002804 19:32779006-32779028 GGGAGGGTCCCAGGATCACCAGG - Intronic
1165068287 19:33241340-33241362 GGGACAGAGCCAGGAGCCCCAGG - Intergenic
1165077974 19:33291309-33291331 GGGTCAGACCCAGGGGCTCAGGG - Intergenic
1167594082 19:50418330-50418352 GGGGCAGCCCCAGGCGCACCGGG + Intronic
1168059152 19:53881922-53881944 GGGTCAGACACAGGGACCCCAGG + Intronic
1168293182 19:55367006-55367028 GGGTCAGGCCCTGGATCTCAAGG + Intronic
1168326536 19:55541364-55541386 GGGTCAGACCCAGGTCTCCCAGG + Exonic
1168639348 19:58020381-58020403 GGGACACACCCAGGGCCACCAGG - Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925379896 2:3417369-3417391 TGGTCAGACGCTGCATCACCTGG - Intronic
928093462 2:28390570-28390592 GGGAGAGACCCAGAAGCACCCGG + Intergenic
928266997 2:29820698-29820720 GGGTCAGACCCAGCACTTCCAGG - Intronic
930718414 2:54614993-54615015 GGGTGAGAGACAGGCTCACCAGG - Intronic
933815551 2:86065426-86065448 GGGACTGATCCAGGATCACATGG - Exonic
935194878 2:100807334-100807356 CGGTCAGCACCAGAATCACCTGG - Intergenic
938942274 2:136179612-136179634 TGGCCAGACCCAGGGCCACCTGG - Intergenic
940540420 2:155009279-155009301 GGGTAAGACACAGGAGCTCCAGG - Intergenic
942252966 2:174063460-174063482 GGGTCAGTCCTAGGAGAACCAGG - Intergenic
944855645 2:203764494-203764516 GGGCCAGGCCCAGGAGTACCAGG - Intergenic
945993848 2:216419531-216419553 GAGTGAGGACCAGGATCACCAGG - Intronic
947394294 2:229672204-229672226 GAATCAGACGCAGGCTCACCTGG + Intronic
948383318 2:237566603-237566625 GGGCCAGGCCCAGCATCAGCAGG - Exonic
948899761 2:240950330-240950352 GGGTCAGGCTCAGGGTCTCCTGG - Intronic
1169023946 20:2351440-2351462 GGGGCAGAGCCAGGATCCCTAGG - Intergenic
1172124606 20:32617943-32617965 GGCTCGAACCCAGGACCACCTGG + Intergenic
1172448103 20:35003568-35003590 GGGCCAGCATCAGGATCACCAGG + Exonic
1172629868 20:36370868-36370890 GGGTCTGACCCTGTCTCACCTGG - Intronic
1173023009 20:39283713-39283735 TGGACTGACCCAGGATAACCAGG - Intergenic
1175135269 20:56818733-56818755 GTTCCAGAACCAGGATCACCTGG + Intergenic
1175387663 20:58607729-58607751 GGCTCAGACCCTGGCTCACAGGG + Intergenic
1175931523 20:62496017-62496039 GGGCCAGACTCAGGAGCAGCCGG - Intergenic
1176037155 20:63045178-63045200 GGGAAAGACCCAGGGTCTCCAGG - Intergenic
1176429345 21:6566582-6566604 GGGACAGACCCAGGAGGAGCAGG - Intergenic
1179704737 21:43174044-43174066 GGGACAGACCCAGGAGGAGCAGG - Intergenic
1180082749 21:45494142-45494164 GCCTCAGACACAGGATCCCCAGG + Intronic
1180091963 21:45537901-45537923 GGGTCAGGCCCAGGTTCCACGGG + Exonic
1180609137 22:17084746-17084768 GGGCCAGGCCCAGGAGCAGCGGG + Intergenic
1180645401 22:17334485-17334507 GTATCAGAGCCTGGATCACCTGG + Intergenic
1180957923 22:19749539-19749561 GGGTCAGGCTCAGGGTCACCAGG - Intergenic
1181052939 22:20246280-20246302 GGGTAGGACCCAGGATCACCAGG + Intronic
1183990712 22:41595491-41595513 GGTACAGACCCAGGAGGACCAGG + Intergenic
1184230232 22:43154821-43154843 GGGTGGGACCCAGGGTCTCCAGG - Intronic
1184431395 22:44443310-44443332 GGGTCAGGACCAGGACCACAAGG + Intergenic
1185038810 22:48493883-48493905 GGGGCACCGCCAGGATCACCAGG - Intronic
950145345 3:10645958-10645980 GGGTCCCACCCAGGATCAAGTGG - Intronic
953039675 3:39244518-39244540 GGGTTAGAGCCAGGATCAATGGG - Intergenic
954512212 3:51135559-51135581 GGGCCAAACCCAAGATCATCTGG - Intronic
954517329 3:51190481-51190503 GGGACAGACTCAGGACCTCCTGG + Intronic
955908080 3:63828843-63828865 GTTTCAAACCCAGGAACACCTGG + Intronic
955949222 3:64225320-64225342 GGGTCTGGCTCAGGATCAGCTGG - Exonic
956558838 3:70551261-70551283 GGGTCGGGCCCAGGTTCCCCGGG - Intergenic
957312984 3:78543474-78543496 GGGTTCCACCCAGGATGACCTGG - Intergenic
963422123 3:145073533-145073555 GGCTCAGGCCCAGCATCCCCAGG - Intergenic
965204060 3:165698091-165698113 AGGTGTGACCCAAGATCACCAGG + Intergenic
965289696 3:166864516-166864538 GGGACAGACCAAGGGTCATCAGG + Intergenic
966689186 3:182725932-182725954 GTGTCAGCCACAGGATCTCCAGG - Intergenic
966821956 3:183931824-183931846 GGGTCAGACCCAGGACCATCTGG - Intronic
968641415 4:1716847-1716869 GGGGTAGACCCAGGGTCTCCAGG + Exonic
968816732 4:2825235-2825257 GGGTCAGGCCCAGGCGCCCCAGG - Intronic
971320442 4:25601179-25601201 GGGTCACACCTTGAATCACCAGG - Intergenic
972074013 4:35060596-35060618 GCTCCAGACCCAGGATCATCGGG - Intergenic
978379980 4:108116713-108116735 GATTCACACCCAGGTTCACCAGG - Intronic
991136960 5:63193527-63193549 TGGACAGACTCAGGATCTCCTGG - Intergenic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
997874009 5:137532215-137532237 GGGTGAGTCCCAGGCTCATCTGG - Intronic
999180444 5:149666459-149666481 AAGTGAGCCCCAGGATCACCAGG + Intergenic
999346128 5:150820913-150820935 GGGCCAGGCCCAGGGTCTCCAGG - Intergenic
999422255 5:151454994-151455016 GGGTCAGAACTAGGATCAAGAGG - Intronic
1001410301 5:171506607-171506629 GGGTTTGACCCAGCATGACCTGG + Intergenic
1001519380 5:172379917-172379939 GGTTCAGACTCAGGCTGACCTGG + Intronic
1002100531 5:176855454-176855476 GGGTCAGCCCCTGGACCACGTGG + Intronic
1002314903 5:178337282-178337304 GGGTCTGGCCGGGGATCACCGGG - Intronic
1005692460 6:28320580-28320602 GGGGCCGACCCAGTATCCCCTGG - Intergenic
1006284870 6:33085137-33085159 GGGTCATTTCCAGCATCACCAGG - Exonic
1007518014 6:42428943-42428965 GGGTCACACCCAAGGTCCCCTGG + Intronic
1013191836 6:107810248-107810270 GGGTAGGGCCCAGAATCACCTGG + Intronic
1017375181 6:153760472-153760494 TGGACAGACTCAGGATCTCCCGG - Intergenic
1017928715 6:158933774-158933796 AGATGAGCCCCAGGATCACCTGG + Intergenic
1018949918 6:168372329-168372351 AGGTCAGGCCCAGCAGCACCAGG + Intergenic
1019541033 7:1551083-1551105 GGGTGAGAGCCAGGTCCACCCGG + Intronic
1020055860 7:5117264-5117286 GGGCCAGGCCCAGGATCAGTAGG - Intergenic
1023987257 7:45104080-45104102 GGGCCAGGCCCTGGCTCACCTGG + Exonic
1025959330 7:66205961-66205983 GGGCAAGACCCAGGGACACCTGG - Intronic
1027535593 7:79396348-79396370 GGATCAGTCCCAGAATCAGCTGG + Intronic
1029466454 7:100728339-100728361 CTCTCTGACCCAGGATCACCAGG + Intergenic
1031804612 7:126292842-126292864 GGGTCAGACCCAGGGGGATCTGG - Intergenic
1034072865 7:148203883-148203905 TGGTCAGGCCCAGGAGCACTGGG - Intronic
1035244545 7:157553886-157553908 GGGACAGACCCTGGATAGCCAGG + Intronic
1035271111 7:157720496-157720518 GGGTCGGCCGCTGGATCACCCGG - Intronic
1035413319 7:158663553-158663575 GGGTCAGACCCAGAAGCACTTGG + Intronic
1035785004 8:2253221-2253243 ACGTCTGACCCAGGCTCACCTGG - Intergenic
1037100088 8:15033272-15033294 AGGTCAGCCCCAGAATAACCAGG + Intronic
1040478193 8:47799372-47799394 GGTACAGACCCGCGATCACCTGG + Exonic
1049243345 8:141549674-141549696 GGCTCAGAACCAGGGTCTCCAGG + Intergenic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1050682642 9:8131644-8131666 GTGCAACACCCAGGATCACCAGG - Intergenic
1053428351 9:38025778-38025800 GGGTCTTGCCCAGGGTCACCTGG + Intronic
1053480933 9:38415773-38415795 AGGGCAGCCCCAGGATCAACAGG - Intronic
1060973053 9:127749710-127749732 GGGTCAGACCCAGGATCTGGGGG + Intronic
1061134171 9:128723884-128723906 GGGCCAATCCCAGGATCTCCAGG + Intronic
1061513148 9:131072908-131072930 GAGTCATACCCAAGGTCACCAGG - Intronic
1062021729 9:134322762-134322784 GGGCCAGACCCAGGAGCAGAGGG + Intronic
1187424038 X:19161132-19161154 GGGTCCCACCCTGGAGCACCAGG - Intergenic
1188246429 X:27840802-27840824 GGGTCAGCCTCAGGAGCTCCAGG + Intergenic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1188444482 X:30242192-30242214 TGGTCAGACCCAGGATCTCAAGG + Exonic
1189369592 X:40417144-40417166 GAGTCATACCCAGGAGCCCCAGG - Intergenic
1192494258 X:71604424-71604446 GGGTTAGCCTCAGGATCACTTGG - Exonic
1193179457 X:78436710-78436732 CTGACAGACCCAGGATCCCCAGG - Intergenic
1197032841 X:121838906-121838928 TGTTTAAACCCAGGATCACCTGG + Intergenic