ID: 1188444622

View in Genome Browser
Species Human (GRCh38)
Location X:30243163-30243185
Sequence CCCAACCCATGTGAGATCTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188444618_1188444622 1 Left 1188444618 X:30243139-30243161 CCAGGGCCACATCCAGTAGCTCT 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1188444622 X:30243163-30243185 CCCAACCCATGTGAGATCTAAGG 0: 1
1: 0
2: 1
3: 5
4: 99
1188444615_1188444622 19 Left 1188444615 X:30243121-30243143 CCATGACTAGTGCGTATTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1188444622 X:30243163-30243185 CCCAACCCATGTGAGATCTAAGG 0: 1
1: 0
2: 1
3: 5
4: 99
1188444619_1188444622 -5 Left 1188444619 X:30243145-30243167 CCACATCCAGTAGCTCTTCCCAA 0: 1
1: 0
2: 0
3: 19
4: 212
Right 1188444622 X:30243163-30243185 CCCAACCCATGTGAGATCTAAGG 0: 1
1: 0
2: 1
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188444622 Original CRISPR CCCAACCCATGTGAGATCTA AGG Exonic
902968407 1:20029101-20029123 CCAAGCCCATGTGTGATCCAAGG - Intronic
904717647 1:32481001-32481023 CCCTACCCCTGTGAGACCTGCGG + Exonic
907043531 1:51284692-51284714 GCCAACCCATGGGAGAGCTGAGG + Intergenic
907995252 1:59624806-59624828 CCCACAACATGTGAGATTTATGG + Intronic
908948732 1:69533116-69533138 CCCAAACCATGTCAAATCCAGGG - Intergenic
909617191 1:77624393-77624415 CCCAACCCTTGTGTGCTCTGGGG + Intronic
910727219 1:90351668-90351690 CCCCACCCATATGAGGTCTCAGG + Intergenic
917433785 1:174999202-174999224 CCAAACCCAGGCGAGAACTACGG + Intronic
920532802 1:206716559-206716581 TCCACCCCCTGTGAGATCTGTGG + Intronic
920594411 1:207254823-207254845 CCCACCACATGTGAGAATTATGG + Intergenic
921359564 1:214318177-214318199 CCCAACCCATGTGAAATCTGTGG - Intronic
1062761438 10:24649-24671 ACCAACCCATATGACCTCTAAGG - Intergenic
1063856105 10:10255750-10255772 CCCACCACATGTGAGAATTATGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066003953 10:31130215-31130237 CCCAACCCAGGAGTGATCAATGG - Intergenic
1068539309 10:58273341-58273363 GCCAGCCTATGGGAGATCTAAGG + Intronic
1079163441 11:18014496-18014518 CTCAACCCATCTCAGGTCTAAGG + Intergenic
1085973623 11:81624290-81624312 CTCAGCCCATGTGAGTGCTAGGG - Intergenic
1086872135 11:92050534-92050556 ACAAACCCATGTGAGTTCTTTGG - Intergenic
1087215170 11:95485920-95485942 GACAATCCATGTGAAATCTAAGG + Intergenic
1087829970 11:102808720-102808742 CCCAAGACATGTGAGAATTATGG - Intergenic
1088321005 11:108554601-108554623 CCCAACACAAAAGAGATCTATGG + Intronic
1089093336 11:115897024-115897046 TCCAAACCATGGGAAATCTATGG + Intergenic
1089711677 11:120319405-120319427 CCCAGCCCATGTGGGAACTCTGG - Exonic
1095329708 12:40944085-40944107 CCAAACAAATGTGAGATCCAAGG - Exonic
1097949840 12:65415474-65415496 CCTAACCCAGGTGCTATCTATGG - Intronic
1102902625 12:116650196-116650218 CCCAACCCTTTTGACAGCTAAGG - Intergenic
1104502837 12:129302826-129302848 CTCCACCCATGTGAGACCAAAGG + Intronic
1105551344 13:21398836-21398858 CTCAGCCCATGTGAGCGCTAGGG + Intronic
1105949486 13:25216650-25216672 CCCAACCAATATGAAATCTGTGG - Intergenic
1106184715 13:27399263-27399285 CCCTACCCATGTGTGTTTTATGG - Intergenic
1107554176 13:41503084-41503106 CCCAATCCTTGTGAACTCTAAGG - Intergenic
1109102202 13:58199539-58199561 CCCAAAACATGTGGGATTTATGG - Intergenic
1110081230 13:71315834-71315856 CCCAACTTATCTGAGATGTAAGG + Intergenic
1112574510 13:100623577-100623599 CCCACCCCATCTGACATTTAGGG - Intronic
1113034136 13:106030056-106030078 CTCATCACATGTGAGCTCTATGG - Intergenic
1118703605 14:68459894-68459916 CCCAACCAATGTGAGATTTGGGG + Intronic
1121706496 14:95999761-95999783 ACCAACTAATGTGAAATCTAAGG + Intergenic
1122301600 14:100734270-100734292 CCCAACCCATGCGAGAACGACGG + Exonic
1122881960 14:104694195-104694217 GCCAACCCAGGTCAGAGCTACGG + Intronic
1125532743 15:40424207-40424229 CCCAGCACCTGTAAGATCTAAGG + Intronic
1127981261 15:64037116-64037138 CCCAACCCATGTGACCCCAAAGG + Intronic
1130950253 15:88580972-88580994 CCCAGCCTTTGTGAGATGTAAGG + Intergenic
1133257882 16:4529144-4529166 CCAAACTCATGGGAGACCTATGG - Intronic
1134236594 16:12471085-12471107 CCCAAAGCATGTCAGATCTCGGG - Intronic
1149854984 17:60074650-60074672 CCTCTCCCATGTGAGACCTAAGG + Intronic
1150217940 17:63480626-63480648 CCCCACACATGTGAGATGTGAGG - Intergenic
1152954345 18:24979-25001 ACCAACCCATATGACCTCTAAGG - Intergenic
1155501572 18:26491949-26491971 CCCACCCCAAGTGGGATCTTTGG - Intronic
1159000762 18:62973021-62973043 CCCAAATCATGTGAGCTGTAGGG + Intronic
1160536597 18:79597816-79597838 CCCCACCCCTGTGAGGTCCACGG - Intergenic
1162129929 19:8520179-8520201 CCAAACCCATCTGGGACCTATGG - Intergenic
1164460144 19:28440036-28440058 CCAAACCCATGTGAATTCAAAGG + Intergenic
1167048202 19:47063795-47063817 CCCTACCCATGTGATAGCCAGGG - Intergenic
1168628987 19:57942521-57942543 ACCAACCCCTGTGAGATATGTGG - Exonic
927916672 2:26941542-26941564 CCCCACCCATGAGAGTACTATGG - Intronic
932516435 2:72354910-72354932 CCCACACCATTTTAGATCTAAGG + Intronic
935352929 2:102169939-102169961 CACAAACCATGTAATATCTAAGG + Intronic
936502837 2:113079833-113079855 CACAACTCATGTCAGTTCTAGGG + Intergenic
940725053 2:157327660-157327682 CCGAACCCCTGTGGGATCTCTGG - Exonic
940901186 2:159128142-159128164 CCAAAGACAAGTGAGATCTAGGG - Intronic
941906995 2:170726276-170726298 CCCAATCCCTGAGAGATCAAGGG + Intergenic
943137133 2:183928111-183928133 CCCCTCCCACGTGAGAGCTATGG + Intergenic
944758679 2:202790669-202790691 CCCAACCCATGAGGGATCTGGGG - Intronic
946431399 2:219628773-219628795 CCCAGACCAGGGGAGATCTAGGG + Intronic
948680743 2:239632980-239633002 CCCAGCCCATCTTAGATCTCTGG + Intergenic
1170616135 20:17953249-17953271 CCAAACCCCTGTGTCATCTAGGG - Intronic
1174277739 20:49416020-49416042 CACAGCCCATGTGAGACCTCTGG - Intronic
1176181760 20:63752729-63752751 CCCTACCCCTGCGAGATCTGCGG - Exonic
1182881543 22:33738234-33738256 CCCAACCCAGGTGTGCTCAAAGG + Intronic
1183598003 22:38823685-38823707 ACCAACCCCTGTGTGATCTGGGG + Intronic
1184975248 22:48057244-48057266 CCCATCCCATGTGACCTCCAGGG + Intergenic
1185029790 22:48436214-48436236 CTCAAAGCATGTGAGAACTAGGG + Intergenic
950533523 3:13566715-13566737 CACACCCCATGTGACATCTCAGG + Intronic
961457114 3:127029760-127029782 CCCCACCCATGTGGGATTTTGGG - Intronic
962197771 3:133378615-133378637 CCCAACCCATGTGTTGTCAACGG + Intronic
967769872 3:193322915-193322937 CCTAACTCATCTGAGAGCTATGG - Intronic
971815194 4:31477694-31477716 CCCACAACATGTGAGATTTATGG - Intergenic
982577622 4:157135399-157135421 CCCACCACATGTGAGAATTATGG - Intronic
987678268 5:21103895-21103917 CCCAACCCTAGTGAGAGCTAGGG + Intergenic
990446343 5:55897255-55897277 GCCAACCAATGTGAGATTTGGGG - Intronic
990857574 5:60287311-60287333 CTCAACCCATCTGACAGCTAGGG - Intronic
992408642 5:76483697-76483719 CCCAACCCATGGGGGAGCTGAGG - Intronic
996135286 5:119833983-119834005 GCCAACCCATGTGGGATATGTGG + Intergenic
997357095 5:133269723-133269745 CCCAACCAAAGTGAGCTCAAAGG - Intronic
1000910183 5:167012671-167012693 CCCAACCAAAGGGAGATGTAGGG + Intergenic
1011215883 6:85005141-85005163 CCAAACTCATGTTAGATCAAAGG + Intergenic
1013632748 6:112001036-112001058 CCCAACCAAGGTGAGAGTTAAGG + Intergenic
1018823932 6:167395285-167395307 CCCACCCCATGGAAGATCTCAGG + Intergenic
1023337889 7:39189001-39189023 CCCAAACCATGTGGGAGGTATGG - Intronic
1030201443 7:106909631-106909653 CCCAACCCAAGTAACATCCAAGG + Intergenic
1033574363 7:142665988-142666010 CACAACCCTTATGAAATCTAAGG + Intergenic
1034295205 7:149966276-149966298 CCCATCTGATGTGAGATCTGAGG + Intergenic
1035760986 8:2068687-2068709 TCCATCCCATGCGAGTTCTAAGG - Intronic
1039088449 8:33802814-33802836 AGCAGCCCCTGTGAGATCTAGGG - Intergenic
1039838411 8:41276236-41276258 CCCAAGACATGTGTGATCTGGGG - Intronic
1057882772 9:98805990-98806012 CCCAACACATTTAAGATCTGCGG - Intergenic
1203783831 EBV:116083-116105 CCAAACGCATGAGAGAGCTATGG - Intergenic
1188444622 X:30243163-30243185 CCCAACCCATGTGAGATCTAAGG + Exonic
1188445786 X:30251524-30251546 CCCACCCCATGTGAGAACTCAGG + Exonic
1197739059 X:129875346-129875368 CCCATCCTATGTGAAATCTGTGG + Intergenic
1198413809 X:136399067-136399089 CCAAACACAGGTGAAATCTATGG + Intronic
1200141252 X:153904164-153904186 ACGAACCCCTGTGAGATCCAGGG - Intronic
1201322646 Y:12717191-12717213 CCCAACTCCTGTCAGATCAATGG + Intronic
1201756370 Y:17490574-17490596 ACCAACCCATATGACCTCTAAGG - Intergenic
1201845182 Y:18415411-18415433 ACCAACCCATATGACCTCTAAGG + Intergenic