ID: 1188446361

View in Genome Browser
Species Human (GRCh38)
Location X:30256839-30256861
Sequence GAGGCTAGGGCTATGTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188446353_1188446361 5 Left 1188446353 X:30256811-30256833 CCCCTGTGGACAGTGGATCCTCT No data
Right 1188446361 X:30256839-30256861 GAGGCTAGGGCTATGTGAATAGG No data
1188446355_1188446361 3 Left 1188446355 X:30256813-30256835 CCTGTGGACAGTGGATCCTCTCC No data
Right 1188446361 X:30256839-30256861 GAGGCTAGGGCTATGTGAATAGG No data
1188446350_1188446361 28 Left 1188446350 X:30256788-30256810 CCTATTTGAGGCAGGTATTTCTT No data
Right 1188446361 X:30256839-30256861 GAGGCTAGGGCTATGTGAATAGG No data
1188446354_1188446361 4 Left 1188446354 X:30256812-30256834 CCCTGTGGACAGTGGATCCTCTC No data
Right 1188446361 X:30256839-30256861 GAGGCTAGGGCTATGTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188446361 Original CRISPR GAGGCTAGGGCTATGTGAAT AGG Intergenic
No off target data available for this crispr