ID: 1188459187

View in Genome Browser
Species Human (GRCh38)
Location X:30403731-30403753
Sequence TGAGTGAAGTAGCATACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188459187_1188459189 -6 Left 1188459187 X:30403731-30403753 CCACCTGTATGCTACTTCACTCA No data
Right 1188459189 X:30403748-30403770 CACTCACTCATTTTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188459187 Original CRISPR TGAGTGAAGTAGCATACAGG TGG (reversed) Intergenic
No off target data available for this crispr