ID: 1188459189

View in Genome Browser
Species Human (GRCh38)
Location X:30403748-30403770
Sequence CACTCACTCATTTTTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188459187_1188459189 -6 Left 1188459187 X:30403731-30403753 CCACCTGTATGCTACTTCACTCA No data
Right 1188459189 X:30403748-30403770 CACTCACTCATTTTTCTGTCTGG No data
1188459186_1188459189 8 Left 1188459186 X:30403717-30403739 CCTGGCTTCAACTACCACCTGTA No data
Right 1188459189 X:30403748-30403770 CACTCACTCATTTTTCTGTCTGG No data
1188459188_1188459189 -9 Left 1188459188 X:30403734-30403756 CCTGTATGCTACTTCACTCACTC No data
Right 1188459189 X:30403748-30403770 CACTCACTCATTTTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188459189 Original CRISPR CACTCACTCATTTTTCTGTC TGG Intergenic
No off target data available for this crispr