ID: 1188459493

View in Genome Browser
Species Human (GRCh38)
Location X:30407272-30407294
Sequence CTACAGAAATGGAAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188459493_1188459497 26 Left 1188459493 X:30407272-30407294 CCCTCTTCTTTCCATTTCTGTAG No data
Right 1188459497 X:30407321-30407343 AGACTGTCATCATTATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188459493 Original CRISPR CTACAGAAATGGAAAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr