ID: 1188461764

View in Genome Browser
Species Human (GRCh38)
Location X:30435373-30435395
Sequence TTCTTCAGTGGCCCGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461764_1188461769 -8 Left 1188461764 X:30435373-30435395 CCCATTTCCGGGCCACTGAAGAA No data
Right 1188461769 X:30435388-30435410 CTGAAGAAGACCTGGCCCTAAGG No data
1188461764_1188461771 6 Left 1188461764 X:30435373-30435395 CCCATTTCCGGGCCACTGAAGAA No data
Right 1188461771 X:30435402-30435424 GCCCTAAGGTCAGCACACTGAGG No data
1188461764_1188461774 29 Left 1188461764 X:30435373-30435395 CCCATTTCCGGGCCACTGAAGAA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461764 Original CRISPR TTCTTCAGTGGCCCGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr