ID: 1188461768

View in Genome Browser
Species Human (GRCh38)
Location X:30435385-30435407
Sequence TAGGGCCAGGTCTTCTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461768_1188461774 17 Left 1188461768 X:30435385-30435407 CCACTGAAGAAGACCTGGCCCTA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461768_1188461771 -6 Left 1188461768 X:30435385-30435407 CCACTGAAGAAGACCTGGCCCTA No data
Right 1188461771 X:30435402-30435424 GCCCTAAGGTCAGCACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461768 Original CRISPR TAGGGCCAGGTCTTCTTCAG TGG (reversed) Intergenic
No off target data available for this crispr