ID: 1188461770

View in Genome Browser
Species Human (GRCh38)
Location X:30435398-30435420
Sequence AGTGTGCTGACCTTAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461770_1188461774 4 Left 1188461770 X:30435398-30435420 CCTGGCCCTAAGGTCAGCACACT No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461770 Original CRISPR AGTGTGCTGACCTTAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr