ID: 1188461773

View in Genome Browser
Species Human (GRCh38)
Location X:30435404-30435426
Sequence TGCCTCAGTGTGCTGACCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461773_1188461774 -2 Left 1188461773 X:30435404-30435426 CCTAAGGTCAGCACACTGAGGCA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461773_1188461776 30 Left 1188461773 X:30435404-30435426 CCTAAGGTCAGCACACTGAGGCA No data
Right 1188461776 X:30435457-30435479 CTACAGCTCCACCACTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461773 Original CRISPR TGCCTCAGTGTGCTGACCTT AGG (reversed) Intergenic
No off target data available for this crispr