ID: 1188461774

View in Genome Browser
Species Human (GRCh38)
Location X:30435425-30435447
Sequence CACTGATTCGAATTGACCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461772_1188461774 -1 Left 1188461772 X:30435403-30435425 CCCTAAGGTCAGCACACTGAGGC No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461763_1188461774 30 Left 1188461763 X:30435372-30435394 CCCCATTTCCGGGCCACTGAAGA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461766_1188461774 22 Left 1188461766 X:30435380-30435402 CCGGGCCACTGAAGAAGACCTGG No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461770_1188461774 4 Left 1188461770 X:30435398-30435420 CCTGGCCCTAAGGTCAGCACACT No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461768_1188461774 17 Left 1188461768 X:30435385-30435407 CCACTGAAGAAGACCTGGCCCTA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461765_1188461774 28 Left 1188461765 X:30435374-30435396 CCATTTCCGGGCCACTGAAGAAG No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461764_1188461774 29 Left 1188461764 X:30435373-30435395 CCCATTTCCGGGCCACTGAAGAA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data
1188461773_1188461774 -2 Left 1188461773 X:30435404-30435426 CCTAAGGTCAGCACACTGAGGCA No data
Right 1188461774 X:30435425-30435447 CACTGATTCGAATTGACCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461774 Original CRISPR CACTGATTCGAATTGACCGT AGG Intergenic
No off target data available for this crispr