ID: 1188461776

View in Genome Browser
Species Human (GRCh38)
Location X:30435457-30435479
Sequence CTACAGCTCCACCACTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461775_1188461776 -7 Left 1188461775 X:30435441-30435463 CCGTAGGTAGCAGTTGCTACAGC No data
Right 1188461776 X:30435457-30435479 CTACAGCTCCACCACTGAGAAGG No data
1188461773_1188461776 30 Left 1188461773 X:30435404-30435426 CCTAAGGTCAGCACACTGAGGCA No data
Right 1188461776 X:30435457-30435479 CTACAGCTCCACCACTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461776 Original CRISPR CTACAGCTCCACCACTGAGA AGG Intergenic
No off target data available for this crispr