ID: 1188461782

View in Genome Browser
Species Human (GRCh38)
Location X:30435516-30435538
Sequence CATAAGAGGGAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188461782_1188461789 20 Left 1188461782 X:30435516-30435538 CCCTCCTCCTGCTCCCTCTTATG No data
Right 1188461789 X:30435559-30435581 ACATCAGCACTGTTTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188461782 Original CRISPR CATAAGAGGGAGCAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr