ID: 1188465058

View in Genome Browser
Species Human (GRCh38)
Location X:30470367-30470389
Sequence CAGTAGAAATGGTGAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188465058_1188465065 26 Left 1188465058 X:30470367-30470389 CCCACTACTCACCATTTCTACTG No data
Right 1188465065 X:30470416-30470438 CTAGCCACCACTGTCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188465058 Original CRISPR CAGTAGAAATGGTGAGTAGT GGG (reversed) Intergenic
No off target data available for this crispr