ID: 1188465304 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:30472818-30472840 |
| Sequence | CTGTGTTATGAATAGGAAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188465304_1188465307 | 2 | Left | 1188465304 | X:30472818-30472840 | CCCACTTCCTATTCATAACACAG | No data | ||
| Right | 1188465307 | X:30472843-30472865 | ACGTCTCCAAGAACAAGAAGTGG | No data | ||||
| 1188465304_1188465309 | 14 | Left | 1188465304 | X:30472818-30472840 | CCCACTTCCTATTCATAACACAG | No data | ||
| Right | 1188465309 | X:30472855-30472877 | ACAAGAAGTGGATCAGAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188465304 | Original CRISPR | CTGTGTTATGAATAGGAAGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||