ID: 1188465304

View in Genome Browser
Species Human (GRCh38)
Location X:30472818-30472840
Sequence CTGTGTTATGAATAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188465304_1188465307 2 Left 1188465304 X:30472818-30472840 CCCACTTCCTATTCATAACACAG No data
Right 1188465307 X:30472843-30472865 ACGTCTCCAAGAACAAGAAGTGG No data
1188465304_1188465309 14 Left 1188465304 X:30472818-30472840 CCCACTTCCTATTCATAACACAG No data
Right 1188465309 X:30472855-30472877 ACAAGAAGTGGATCAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188465304 Original CRISPR CTGTGTTATGAATAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr